Plasmids   Select Another Resource Report Type

http://www.addgene.org/60901

Vector Backbone Description: Backbone Size:9070; Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27030102
Comments: The gRNA cloning strategy is exactly the same as for pX330/pX335.

Proper citation: RRID:Addgene_60901 Copy   

•   Source: Addgene

http://www.addgene.org/60989

Species: Synthetic
Genetic Insert: mKO
Vector Backbone Description: Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26010570
Comments: Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region.

Proper citation: RRID:Addgene_60989 Copy   

•   Source: Addgene

http://www.addgene.org/60907

Genetic Insert: scFv-GCN4
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60907 Copy   

•   Source: Addgene

http://www.addgene.org/60906

Genetic Insert: scFv-GCN4
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60906 Copy   

•   Source: Addgene

http://www.addgene.org/60905

Genetic Insert: BFP
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60905 Copy   

•   Source: Addgene

http://www.addgene.org/60980

Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26010570
Comments: Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region.

Proper citation: RRID:Addgene_60980 Copy   

•   Source: Addgene

http://www.addgene.org/60874

Species: Homo sapiens
Genetic Insert: 204 bp promoter fragment of Cancerous Inhibitor of PP2A
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10(luc2); Vector Types:Luciferase, Promoterless; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21445343
Comments: Then various length luciferase promoter constructs were created using the Deletion Kit for Kilo-Sequencing (Takara Bio Inc., Japan) as per the manufacturer’s instructions. Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

Proper citation: RRID:Addgene_60874 Copy   

•   Source: Addgene

http://www.addgene.org/60873

Species: Homo sapiens
Genetic Insert: 285 bp promoter fragment of Cancerous Inhibitor of PP2A2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10(luc2); Vector Types:Luciferase, Promoterless; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21445343
Comments: Then various length luciferase promoter constructs were created using the Deletion Kit for Kilo-Sequencing (Takara Bio Inc., Japan) as per the manufacturer’s instructions. Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

Proper citation: RRID:Addgene_60873 Copy   

•   Source: Addgene

http://www.addgene.org/60910

Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60910 Copy   

•   Source: Addgene

http://www.addgene.org/60914

Genetic Insert: mito-mCherry
Vector Backbone Description: Vector Backbone:pcDNA4TO; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60914 Copy   

•   Source: Addgene

http://www.addgene.org/60913

Genetic Insert: mito-mCherry
Vector Backbone Description: Vector Backbone:pcDNA4TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60913 Copy   

•   Source: Addgene

http://www.addgene.org/60879

Species: Homo sapiens
Genetic Insert: Polo-like kinase 1
Vector Backbone Description: Backbone Size:4969; Vector Backbone:pGEX-4T-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23455152

Proper citation: RRID:Addgene_60879 Copy   

•   Source: Addgene

http://www.addgene.org/60916

Genetic Insert: AAVS1-ZFNL
Vector Backbone Description: Vector Backbone:PUC18; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25630922

Proper citation: RRID:Addgene_60916 Copy   

•   Source: Addgene

http://www.addgene.org/60909

Genetic Insert: K560-E236A
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA4TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60909 Copy   

•   Source: Addgene

http://www.addgene.org/60991

Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26010570
Comments: Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region.

Proper citation: RRID:Addgene_60991 Copy   

•   Source: Addgene

http://www.addgene.org/60990

Species: Synthetic
Genetic Insert: dTomato
Vector Backbone Description: Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26010570
Comments: Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region.

Proper citation: RRID:Addgene_60990 Copy   

•   Source: Addgene

http://www.addgene.org/61051

Species: Synthetic
Genetic Insert: EGFP sgRNA
Vector Backbone Description: Backbone Marker:Joung Lab, Addgene plasmid # 42250; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24179142
Comments: eGFP sgRNA = GGCGAGGGCGATGCCACCTA

Proper citation: RRID:Addgene_61051 Copy   

•   Source: Addgene

http://www.addgene.org/61178

Genetic Insert: AtVHA-a1
Vector Backbone Description: Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881

Proper citation: RRID:Addgene_61178 Copy   

•   Source: Addgene

http://www.addgene.org/61056

Genetic Insert: sfGFP-24xGCN4_v1 peptide array
Vector Backbone Description: Vector Backbone:pcDNA4TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit http://valelab.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_61056 Copy   

•   Source: Addgene

http://www.addgene.org/61177

Genetic Insert: MtSYP41
Vector Backbone Description: Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881

Proper citation: RRID:Addgene_61177 Copy   

•   Source: Addgene