Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pXFokI-dCas9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_60901 | Ampicillin | PMID:27030102 | The gRNA cloning strategy is exactly the same as for pX330/pX335. | Backbone Size:9070; Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 1 | |||
|
pMTB-Multibow-mO Resource Report Resource Website |
RRID:Addgene_60989 | mKO | Synthetic | Ampicillin | PMID:26010570 | Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. | Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 0 | |
|
pHR-scFv-GCN4-sfGFP-GB1-dWPRE Resource Report Resource Website 10+ mentions |
RRID:Addgene_60907 | scFv-GCN4 | Ampicillin | PMID:25307933 | For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html | Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 20 | ||
|
pHR-scFv-GCN4-sfGFP-GB1-NLS-dWPRE Resource Report Resource Website 10+ mentions |
RRID:Addgene_60906 | scFv-GCN4 | Ampicillin | PMID:25307933 | For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html | Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 34 | ||
|
pLV-sgCDKN1B#2 BFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_60905 | BFP | Ampicillin | PMID:25307933 | For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html | Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 1 | ||
|
pMTB-Multibow-G Resource Report Resource Website |
RRID:Addgene_60980 | EGFP | Synthetic | Ampicillin | PMID:26010570 | Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. | Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 0 | |
|
CIP2Aprom204bp-pGL4.10Luc Resource Report Resource Website |
RRID:Addgene_60874 | 204 bp promoter fragment of Cancerous Inhibitor of PP2A | Homo sapiens | Ampicillin | PMID:21445343 | Then various length luciferase promoter constructs were created using the Deletion Kit for Kilo-Sequencing (Takara Bio Inc., Japan) as per the manufacturer’s instructions. Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function. | Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10(luc2); Vector Types:Luciferase, Promoterless; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 0 | |
|
CIP2Aprom285bp-pGL4.10Luc Resource Report Resource Website |
RRID:Addgene_60873 | 285 bp promoter fragment of Cancerous Inhibitor of PP2A2 | Homo sapiens | Ampicillin | PMID:21445343 | Then various length luciferase promoter constructs were created using the Deletion Kit for Kilo-Sequencing (Takara Bio Inc., Japan) as per the manufacturer’s instructions. Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function. | Backbone Marker:Promega; Backbone Size:4242; Vector Backbone:pGL4.10(luc2); Vector Types:Luciferase, Promoterless; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 0 | |
|
pHRdSV40-NLS-dCas9-24xGCN4_v4-NLS-P2A-BFP-dWPRE Resource Report Resource Website 10+ mentions |
RRID:Addgene_60910 | dCas9 | Ampicillin | PMID:25307933 | For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html | Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 29 | ||
|
pcDNA4TO-mito-mCherry-10xGCN4_v4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_60914 | mito-mCherry | Ampicillin | PMID:25307933 | For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html | Vector Backbone:pcDNA4TO; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 7 | ||
|
pcDNA4TO-mito-mCherry-24xGCN4_v1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_60913 | mito-mCherry | Ampicillin | PMID:25307933 | For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html | Vector Backbone:pcDNA4TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 4 | ||
|
GST-PBD H538A/K540M Resource Report Resource Website |
RRID:Addgene_60879 | Polo-like kinase 1 | Homo sapiens | Ampicillin | PMID:23455152 | Backbone Size:4969; Vector Backbone:pGEX-4T-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | H538A/K540M | 2026-08-15 01:17:37 | 0 | |
|
PGK-AAVS1ZFNL Resource Report Resource Website 1+ mentions |
RRID:Addgene_60916 | AAVS1-ZFNL | Ampicillin | PMID:25630922 | Vector Backbone:PUC18; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 1 | |||
|
pcDNA4TO-K560-E236A-24xGCN4_v1-IRES-Puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_60909 | K560-E236A | Ampicillin | PMID:25307933 | For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html | Backbone Marker:Invitrogen; Vector Backbone:pcDNA4TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:37 | 5 | ||
|
pMTB-Multibow-mfR Resource Report Resource Website 1+ mentions |
RRID:Addgene_60991 | mKate2 | Synthetic | Ampicillin | PMID:26010570 | Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. | Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 1 | |
|
pMTB-Multibow-mR Resource Report Resource Website |
RRID:Addgene_60990 | dTomato | Synthetic | Ampicillin | PMID:26010570 | Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. | Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 0 | |
|
DR274-eGFP sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_61051 | EGFP sgRNA | Synthetic | Kanamycin | PMID:24179142 | eGFP sgRNA = GGCGAGGGCGATGCCACCTA | Backbone Marker:Joung Lab, Addgene plasmid # 42250; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:38 | 3 | |
|
pCMU-TGNVHAr Resource Report Resource Website |
RRID:Addgene_61178 | AtVHA-a1 | Spectinomycin | PMID:25329881 | Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:17:39 | 0 | |||
|
pcDNA4TO-sfGFP-24xGCN4_v1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61056 | sfGFP-24xGCN4_v1 peptide array | Ampicillin | PMID:25307933 | For more information, visit http://valelab.ucsf.edu/external/research/suntag.html | Vector Backbone:pcDNA4TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 1 | ||
|
pCMB-TGN41r Resource Report Resource Website |
RRID:Addgene_61177 | MtSYP41 | Spectinomycin | PMID:25329881 | Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:17:39 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
