Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: GFP-N2-PKCdelta-C1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4596; Vector Backbone:N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11509231
Proper citation: RRID:Addgene_21216 Copy
Species: Rattus norvegicus
Genetic Insert: GFP-pcDNA3-PKCgamma-c2
Vector Backbone Description: Backbone Size:5429; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11509231
Proper citation: RRID:Addgene_21215 Copy
Species: Rattus norvegicus
Genetic Insert: CAMKIIalpha-T286A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:0; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10102820
Proper citation: RRID:Addgene_21220 Copy
Species: Rattus norvegicus
Genetic Insert: CAMKIIalpha
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4725; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9768845
Proper citation: RRID:Addgene_21226 Copy
Species: Rattus norvegicus
Genetic Insert: CaMKIIbeta(A303R)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:0; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10102820
Proper citation: RRID:Addgene_21224 Copy
Species: Rattus norvegicus
Genetic Insert: ROMK1
Vector Backbone Description: Backbone Marker:Didier Trono; Backbone Size:10000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10938328
Proper citation: RRID:Addgene_21322 Copy
Species: Rattus norvegicus
Genetic Insert: Dazl shRNA-1
Vector Backbone Description: Backbone Size:8264; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Comments: Dazl shRNA sequence is - 5'-TTTGGGCTATGGATTTGTCTCATTCAAGAGATGAGACAAATCCATAGCCCTTTT
Proper citation: RRID:Addgene_21621 Copy
Species: Rattus norvegicus
Genetic Insert: Gene33
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10749885
Comments: Plasmid was also used in Xu et al. 2005
the construct can be used in cardiomyocytes
There is a V to L amino acid change at position 6. The lab feels it is conservative enough not to matter.
Proper citation: RRID:Addgene_21633 Copy
Species: Rattus norvegicus
Genetic Insert: mTOR (1271-2008)
Vector Backbone Description: Backbone Marker:BD Pharmingen; Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12718876
Proper citation: RRID:Addgene_21746 Copy
Species: Rattus norvegicus
Genetic Insert: Mef2a
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:3176; Vector Backbone:pSuper; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16484497
Comments: Can be used in conjunction with pcDNA3-rMEF2A (Addgene #32901) which is mutated so as to not be targeted by this shRNA.
Proper citation: RRID:Addgene_32899 Copy
Species: Rattus norvegicus
Genetic Insert: EGFP-rat NFM fusion
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4134; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10707083
Comments: Plasmid first described in Wang et al. (2000) "Rapid movement of axonal neurofilaments interrupted by prolonged pauses" Nature Cell Biology 2:137-141.
Proper citation: RRID:Addgene_32907 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Comments: The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations.
Proper citation: RRID:Addgene_33332 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase alpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Proper citation: RRID:Addgene_33331 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21669867
Comments: The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations.
Proper citation: RRID:Addgene_33321 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Comments: The truncation was made by placing a stop codon at 460, but sequence was not actually removed.
The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations.
Proper citation: RRID:Addgene_33325 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase alpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21807092
Proper citation: RRID:Addgene_33328 Copy
Species: Rattus norvegicus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21669867
Comments: Please note that, according to NCBI numbering, the mutation is actually S571A.
Proper citation: RRID:Addgene_33319 Copy
Species: Rattus norvegicus
Genetic Insert: LAMP1
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22053050
Proper citation: RRID:Addgene_34611 Copy
Species: Rattus norvegicus
Genetic Insert: rat Syntaxin1a
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:4733; Vector Backbone:peGFP(N1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21076040
Proper citation: RRID:Addgene_34631 Copy
Species: Rattus norvegicus
Genetic Insert: PRMT1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4948; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8647869
Proper citation: RRID:Addgene_34699 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
