Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:rattus norvegicus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,175 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
GFP-C1(2)delta
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21216 GFP-N2-PKCdelta-C1 Rattus norvegicus Kanamycin PMID:11509231 Backbone Marker:Clontech; Backbone Size:4596; Vector Backbone:N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin C1(2) domains of PKC delta (rat) (Lab plasmid WC0001) 2026-08-15 01:12:01 6
GFP-C2gamma
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21215 GFP-pcDNA3-PKCgamma-c2 Rattus norvegicus Ampicillin PMID:11509231 Backbone Size:5429; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin The C2-domain from PKCgamma (aa170-260) plus flanking sequence. This insert is thus amino acids 158-284 from PKCgamma (rat). (Lab plasmid WC 0005) 2026-08-15 01:12:01 3
GFP-C1-CAMKIIalpha-T286A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21220 CAMKIIalpha-T286A Rattus norvegicus Kanamycin PMID:10102820 Backbone Marker:Clontech; Backbone Size:0; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin T286A (Lab plasmid KS 0003). 2026-08-15 01:12:01 1
GFP-C1-CAMKIIalpha
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_21226 CAMKIIalpha Rattus norvegicus Kanamycin PMID:9768845 Backbone Marker:Clontech; Backbone Size:4725; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Lab plasmid KS 0001. 2026-08-15 01:12:01 10
pEGFP-C1-CaMKIIbeta(A303R)
 
Resource Report
Resource Website 		RRID:Addgene_21224 CaMKIIbeta(A303R) Rattus norvegicus Kanamycin PMID:10102820 Backbone Marker:Clontech; Backbone Size:0; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin CaMKIIbeta(A303R) (Lab plasmid CF 0002) 2026-08-15 01:12:01 0
pHR'-ROMK1-CITE-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21322 ROMK1 Rattus norvegicus Ampicillin PMID:10938328 Backbone Marker:Didier Trono; Backbone Size:10000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:02 1
pLLU2G-Dazl1
 
Resource Report
Resource Website 		RRID:Addgene_21621 Dazl shRNA-1 Rattus norvegicus Ampicillin Dazl shRNA sequence is - 5'-TTTGGGCTATGGATTTGTCTCATTCAAGAGATGAGACAAATCCATAGCCCTTTT Backbone Size:8264; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:12:03 0
pCMV5-FLAG-Gene33
 
Resource Report
Resource Website 		RRID:Addgene_21633 Gene33 Rattus norvegicus Ampicillin PMID:10749885 Plasmid was also used in Xu et al. 2005 the construct can be used in cardiomyocytes There is a V to L amino acid change at position 6. The lab feels it is conservative enough not to matter. Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:04 0
myc-mTOR (1271-2008 aa)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21746 mTOR (1271-2008) Rattus norvegicus Ampicillin PMID:12718876 Backbone Marker:BD Pharmingen; Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin amino acids 1271-2008 2026-08-15 01:12:05 2
Mef2A-shRNA
 
Resource Report
Resource Website 		RRID:Addgene_32899 Mef2a Rattus norvegicus Ampicillin PMID:16484497 Can be used in conjunction with pcDNA3-rMEF2A (Addgene #32901) which is mutated so as to not be targeted by this shRNA. Backbone Marker:OligoEngine; Backbone Size:3176; Vector Backbone:pSuper; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:13:45 0
pEGFP-rNFM
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_32907 EGFP-rat NFM fusion Rattus norvegicus Kanamycin PMID:10707083 Plasmid first described in Wang et al. (2000) "Rapid movement of axonal neurofilaments interrupted by prolonged pauses" Nature Cell Biology 2:137-141. Backbone Marker:Clontech; Backbone Size:4134; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:50 1
pSG5-FLAG-CaMKKbeta with CaMKKalpha RP domain
 
Resource Report
Resource Website 		RRID:Addgene_33332 Calcium/Calmodulin dependent protein kinase kinase beta Rattus norvegicus Ampicillin PMID:21807092 The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations. Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin CaMKKbeta RP domain (203-225) replaced with CaMKKalpha (167-189) RP domain; S3V, G96R, and P108L 2026-08-15 01:13:48 0
pSG5-FLAG-CaMKK alpha with CaMKKbeta RP domain
 
Resource Report
Resource Website 		RRID:Addgene_33331 Calcium/Calmodulin dependent protein kinase kinase alpha Rattus norvegicus Ampicillin PMID:21807092 Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin CaMKKalpha RP domain (167-189) was replaced with CaMKKbeta RP domain (203-225) using PCR based technique 2026-08-15 01:13:48 0
pSG5-HA-CaMKKbeta rat FL WT
 
Resource Report
Resource Website 		RRID:Addgene_33321 Calcium/Calmodulin dependent protein kinase kinase beta Rattus norvegicus Ampicillin PMID:21669867 The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations. Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S3V, G96R, and P108L 2026-08-15 01:13:55 0
pSG5-FLAG-CaMKKbeta rat 1-460 D311A
 
Resource Report
Resource Website 		RRID:Addgene_33325 Calcium/Calmodulin dependent protein kinase kinase beta Rattus norvegicus Ampicillin PMID:21807092 The truncation was made by placing a stop codon at 460, but sequence was not actually removed. The S3V, G96R, and P108L "mutations" were present in the original version of rat CaMKKbeta cloned by the Means lab. They believe these sequence differences represent a natural variant of the CaMKKbeta sequence and are not mutations. Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin truncated at 460, D311A (S3V, G96R, and P108L also present) 2026-08-15 01:13:48 0
pSG5-FLAG-CaMKKalpha RP deletion
 
Resource Report
Resource Website 		RRID:Addgene_33328 Calcium/Calmodulin dependent protein kinase kinase alpha Rattus norvegicus Ampicillin PMID:21807092 Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Deleted RP domain (amino acids 167-189 missing) 2026-08-15 01:13:48 0
pSG5-FLAG-CaMKKbeta rat S572A
 
Resource Report
Resource Website 		RRID:Addgene_33319 Calcium/Calmodulin dependent protein kinase kinase beta Rattus norvegicus Ampicillin PMID:21669867 Please note that, according to NCBI numbering, the mutation is actually S571A. Backbone Marker:Stratagene; Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S571A 2026-08-15 01:13:48 0
LAMP1-mRFP-FLAG
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_34611 LAMP1 Rattus norvegicus Ampicillin PMID:22053050 Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:54 23
peGFP(N1)-deltaCMV-rSyntaxin1a-meGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_34631 rat Syntaxin1a Rattus norvegicus Kanamycin PMID:21076040 Backbone Marker:clontech; Backbone Size:4733; Vector Backbone:peGFP(N1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:54 3
GST-PRMT1
 
Resource Report
Resource Website 		RRID:Addgene_34699 PRMT1 Rattus norvegicus Ampicillin PMID:8647869 Backbone Marker:Amersham; Backbone Size:4948; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:02 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch