Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pBEN1-SGC
 
Resource Report
Resource Website 		RRID:Addgene_39127 none Kanamycin Backbone Marker:SGC; Vector Backbone:pBEN1-SGC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:25 0
YWHAG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39129 YWHAG Homo sapiens Ampicillin http://www.thesgc.org/structures/2B05/ Backbone Marker:SGC; Vector Backbone:pTvHR21-SGC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:25 1
GUCY1A3
 
Resource Report
Resource Website 		RRID:Addgene_39120 GUCY1A3 Homo sapiens Kanamycin http://www.thesgc.org/structures/3UVJ/ Backbone Marker:SGC; Vector Backbone:pNH-TrxT; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:25 0
GUCY1B3
 
Resource Report
Resource Website 		RRID:Addgene_39121 GUCY1B3 Homo sapiens Kanamycin http://www.thesgc.org/structures/3UVJ/ Backbone Marker:SGC; Vector Backbone:pNIC-CTHF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin This is a complex of two proteins; GUCY1A3 (aa 468 – 680) and a double mutant of GUCY1B3 (aa 408 – 610; G476C, C541S). 2026-08-15 01:14:25 0
TAF1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39117 TAF1 Homo sapiens Kanamycin http://www.thesgc.org/structures/3UV4/ Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:25 1
AURKB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39119 AURKB Homo sapiens Kanamycin http://www.thesgc.org/structures/4AF3/ Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:25 1
TAF1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39118 TAF1 Homo sapiens Kanamycin http://www.thesgc.org/structures/3UV5/ Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:25 2
JMJD5
 
Resource Report
Resource Website 		RRID:Addgene_39113 JMJD5 Homo sapiens Kanamycin http://www.thesgc.org/structures/4AAP/ Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:25 0
LACTB2
 
Resource Report
Resource Website 		RRID:Addgene_39115 LACTB2 Homo sapiens Kanamycin http://www.thesgc.org/structures/4AD9/ Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:25 0
BPTF
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39111 BPTF Homo sapiens Kanamycin http://www.thesgc.org/structures/3UV2/ Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:25 4
ELAC1
 
Resource Report
Resource Website 		RRID:Addgene_39110 ELAC1 Homo sapiens Kanamycin http://www.thesgc.org/structures/3ZWF/ Backbone Marker:SGC; Vector Backbone:pNIC-CTHF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:25 0
CDKL1
 
Resource Report
Resource Website 		RRID:Addgene_39109 CDKL1 Homo sapiens Kanamycin http://www.thesgc.org/structures/4AGU/ Backbone Marker:SGC; Vector Backbone:pNIC-CTHF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:25 0
pFB-Sec-NH
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39189 none Ampicillin Backbone Marker:SGC; Vector Backbone:pFB-Sec-NH; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 1
pCMV5-myc-Erk2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39222 Erk2 Rattus norvegicus Ampicillin PMID:11352917 Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 1
INCENP
 
Resource Report
Resource Website 		RRID:Addgene_39185 INCENP Homo sapiens Ampicillin http://www.thesgc.org/structures/3U23/ Backbone Marker:SGC; Vector Backbone:pGTvL1-SGC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Complex with AURKBA-c004 2026-08-15 01:14:26 0
p2Bac.Flag.p34
 
Resource Report
Resource Website 		RRID:Addgene_39221 p34 Homo sapiens Ampicillin Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 0
p2Bac.Myc.p44
 
Resource Report
Resource Website 		RRID:Addgene_39220 p44 Ampicillin Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 0
AASDHPPT
 
Resource Report
Resource Website 		RRID:Addgene_39192 AASDHPPT Homo sapiens Chloramphenicol http://www.thesgc.org/structures/2BYD/ Backbone Marker:SGC; Vector Backbone:pCOEX-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:14:26 0
pCMV-myc-ERK2-MEK1_fusion
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39194 ERK2-MEK1 Fusion Homo sapiens Ampicillin PMID:9799732 rat ERK2 fused to human MEK1 with a linker in between Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 7
pFB-CT10HF-LIC
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_39191 none Ampicillin Primers for LIC cloning: Add the following 5’ extensions to the PCR primers: Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon) Downstream: GATTGGAAGTAGAGGTTCTCTGC The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. Backbone Marker:SGC; Vector Backbone:pFB-CT10HF-LIC; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin 2026-08-15 01:14:26 8

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch