Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

743,607 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pD649-HAsp-IL1R2-COMP5AP-AviTag-9xHis
 
Resource Report
Resource Website 		RRID:Addgene_157333 IL1R2 Homo sapiens Ampicillin PMID:32822567 Some plasmids in this collection may have an IS4-like element ISVsa5 family transposase upstream of the CMV promoter. Backbone Size:7153; Vector Backbone:pD649; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:02:50 0
pNC-Green0029-35S
 
Resource Report
Resource Website 		RRID:Addgene_193395 Kanamycin PMID:36352791 P35S-NC frame-Tnos Vector Backbone:pGreen0029; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:02:49 0
Cas12Max
 
Resource Report
Resource Website 		RRID:Addgene_195334 human codon-optimized Cas12Max Synthetic Ampicillin PMID:37378659 Backbone Marker:Feng Zhang (Addgene plasmid # 42230); Vector Backbone:px330; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N243R Addgene 2026-10-10 02:02:49 0
pD649-HAsp-CEACAM8-COMP5AP-AviTag-9xHis
 
Resource Report
Resource Website 		RRID:Addgene_157294 CEACAM8 Homo sapiens Ampicillin PMID:32822567 Some plasmids in this collection may have an IS4-like element ISVsa5 family transposase upstream of the CMV promoter. Backbone Size:7153; Vector Backbone:pD649; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:02:50 0
pAAV-CMV-intron-hfCas13d-pA
 
Resource Report
Resource Website 		RRID:Addgene_195864 high fidelity (hf) version of CasRx (hfCas13d) R. flavefaciens Ampicillin PMID:41020266 Vector Backbone:Unknown; Vector Types:AAV; Bacterial Resistance:Ampicillin Yes: GTGGAATACATTACCAACGTGGTGTACGTG Addgene 2026-10-10 02:02:49 0
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
 
Resource Report
Resource Website 		RRID:Addgene_195865 high fidelity (hf) version of CasRx (hfCas13d) R. flavefaciens Ampicillin PMID:41020266 Vector Backbone:Unknown; Vector Types:AAV; Bacterial Resistance:Ampicillin Yes: GTGGAATACATTACCAACGTGGTGTACGTG Addgene 2026-10-10 02:02:49 0
Pcamr-RFP
 
Resource Report
Resource Website 		RRID:Addgene_190614 mScarlet-i Synthetic Kanamycin PMID:34985281 Vector Backbone:p15A; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:02:50 0
pD649-HAsp-NGFR-COMP5AP-AviTag-9xHis
 
Resource Report
Resource Website 		RRID:Addgene_157228 NGFR Homo sapiens Ampicillin PMID:32822567 Some plasmids in this collection may have an IS4-like element ISVsa5 family transposase upstream of the CMV promoter. Backbone Size:7153; Vector Backbone:pD649; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:02:50 0
pAAV-CMV-eBFP2-NLS-pA
 
Resource Report
Resource Website 		RRID:Addgene_183800 eBFP2-NLS Other Ampicillin PMID:28764932 Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:02:49 0
pMRE-Himar-175
 
Resource Report
Resource Website 		RRID:Addgene_185943 mScarlet-I Synthetic Chloramphenicol Please visit https://www.biorxiv.org/content/10.1101/2021.03.26.437257v1 for bioRxiv preprint. Vector Backbone:Unspecified; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol Addgene 2026-10-10 02:02:50 0
pAAV-hSyn-FRISZ-TM
 
Resource Report
Resource Website 		RRID:Addgene_176886 Ig kappa-FRISZ-PDGFR TM Synthetic Ampicillin PMID:36857451 The N-terminal Ig kappa leader sequence is for targeting the synthesized peptide to the secretory pathway. The C-terminal PDGFR transmembrane domain is for anchoring the protein to the mammalian cell surface. AAV derived from this plasmid has been successfully used for wide-field in vivo imaging. We deposit another plasmid, pAAV-hSyn-FRISZ-GPI (Addgene # 177264, not yet tested in vivo), which uses a CD59 leader sequence for secretory pathway targeting and a CD59 GPI for anchoring. We plan to systematically compare various exporting and anchoring strategies. Please visit https://www.biorxiv.org/content/10.1101/2022.06.02.494512v1 for bioRxiv preprint. Backbone Size:4280; Vector Backbone:pAAV-hSyn; Vector Types:AAV; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:02:50 0
GFP-itis pBE-nt
 
Resource Report
Resource Website 		RRID:Addgene_195343 ecTadA(8e)-SpCas9-NG Synthetic Ampicillin PMID:37083425 Please visit https://www.biorxiv.org/content/10.1101/2023.02.06.527367v1 for bioRxiv preprint. Vector Backbone:unknown; Vector Types:CRISPR; Bacterial Resistance:Ampicillin SpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F, A1322R, R1335V, T1337R Addgene 2026-10-10 02:02:49 0
pIS002
 
Resource Report
Resource Website 		RRID:Addgene_194013 C16 Ex3 XTR f1 Mus musculus Kanamycin PMID:37366288 Please visit https://doi.org/10.1101/2022.11.21.517425 for bioRxiv preprint. Vector Backbone:pYTK084; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:02:49 0
pLV-Rtn2b-R60f-mCherry
 
Resource Report
Resource Website 		RRID:Addgene_186607 Human Reticulon 2 mutant R60f Homo sapiens Ampicillin PMID:35609616 Vector Backbone:pLV-eGFP_Addgene#36083; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin c.178insC (R60f) Addgene 2026-10-10 02:02:50 0
Rtn2b-RHD272-472-GFP
 
Resource Report
Resource Website 		RRID:Addgene_186606 Human Reticulon 2 isoform B amino acids 272 to 472 Homo sapiens Kanamycin PMID:35609616 Vector Backbone:mNeonGreen-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Met-Gly-Ser-Lys peptide added at N-terminus for correct insertion at ER membrane Addgene 2026-10-10 02:02:50 0
Rtn2b-RHD272-472-mNeon
 
Resource Report
Resource Website 		RRID:Addgene_186605 Human Reticulon 2 isoform B amino acids 272 to 472 Homo sapiens Kanamycin PMID:35609616 Vector Backbone:mNeonGreen-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Met-Gly-Ser-Lys peptide added at N-terminus for correct insertion at ER membrane Addgene 2026-10-10 02:02:50 0
Rtn2b-NTD136-271-mNeon
 
Resource Report
Resource Website 		RRID:Addgene_186604 Human Reticulon 2 isoform B amino acids 136 to 271 Homo sapiens Kanamycin PMID:35609616 Vector Backbone:mNeonGreen-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-10 02:02:50 0
pD649-HAsp-BTNL9-Fc(DAPA)-AviTag-6xHis
 
Resource Report
Resource Website 		RRID:Addgene_156665 BTNL9 Homo sapiens Ampicillin PMID:32822567 Some plasmids in this collection may have an IS4-like element ISVsa5 family transposase upstream of the CMV promoter. Backbone Size:6106; Vector Backbone:pD649; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Fc region of human IgG contains D265A and P329A mutations (DAPA) Addgene 2026-10-10 02:02:50 0
pBAD/HisB (TIRSTD)-mEos3.2
 
Resource Report
Resource Website 		RRID:Addgene_189719 mEos3.2 Synthetic Ampicillin PMID:35903559 Backbone Marker:Thermo; Vector Backbone:pBAD/HisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:02:50 0
pExp-xMBP-ACE2-CHis
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_194998 ACE2 Homo sapiens Ampicillin PMID:37433017 LIC cloning used 5' site BsaI (destroyed in cloning) and 3' site HindIII (not destroyed). Vector Backbone:pExp-CHis; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-10 02:02:49 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

dkNET community events and announcements in October, 2026

Test 10092026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch