Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: GPR20
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Orphan. Ensembl ID: ENSG00000204882, Uniprot ID: Q99678
Proper citation: RRID:Addgene_213275 Copy
Species: Homo sapiens
Genetic Insert: GPR21
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Orphan. Ensembl ID: ENSG00000188394, Uniprot ID: Q99679
Proper citation: RRID:Addgene_213276 Copy
Species: Homo sapiens
Genetic Insert: GPR27
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Orphan. Ensembl ID: ENSG00000170837, Uniprot ID: Q9NS67
Proper citation: RRID:Addgene_213278 Copy
Species: Homo sapiens
Genetic Insert: cgactcgcccggcagcgcac
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37267110
Proper citation: RRID:Addgene_207607 Copy
Species: Other
Genetic Insert: sgRNA-RL864R with TTTA stretch
Vector Backbone Description: Vector Backbone:pSuper; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28177825
Proper citation: RRID:Addgene_215861 Copy
Species: Serratia marcescens
Genetic Insert: nucA
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pMAL2-PE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: The plasmid expresses a nuclease. Leaky expression of the nuclease may degrade extracted plasmid DNA over time. The plasmid is provided in the NEB T7 Express lysY/Iq strain that is ready to be used for protein expression. It is recommended that this plasmid be maintained in the provided host strain. The plasmid can still be extracted from this host, if plasmid is extracted, use it immediately.
Proper citation: RRID:Addgene_218192 Copy
Species: Homo sapiens
Genetic Insert: Kar2-Beta-Amyloid
Vector Backbone Description: Vector Backbone:pAG426-GAL-ccdb; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_181707 Copy
Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Vector Backbone:pAG416-GAL-ccdb; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_181709 Copy
Species: Homo sapiens
Genetic Insert: B55
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38123684
Proper citation: RRID:Addgene_217378 Copy
Species: Homo sapiens
Genetic Insert: CGCTATCAAGATTTATACCT
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207105 Copy
Species: Synthetic
Genetic Insert: sgCTG
Vector Backbone Description: Backbone Marker:Genscript; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_216734 Copy
Species: Fusarium graminearum PH-1
Genetic Insert: Left border of the TSI locus 1-split fragment of geneticin cassette
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2974; Vector Backbone:pJET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38409036
Proper citation: RRID:Addgene_213468 Copy
Species: S pyogenes
Genetic Insert: Cas9-D10A nickase
Vector Backbone Description: Backbone Marker:Genscript; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_216736 Copy
Species: S pyogenes
Genetic Insert: Cas9-D10A nickase
Vector Backbone Description: Backbone Marker:Genscript; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_216737 Copy
Species: Homo sapiens
Genetic Insert: MAP2K1
Vector Backbone Description: Backbone Size:7565; Vector Backbone:pCW107-V5; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_217301 Copy
Species: Homo sapiens
Genetic Insert: Dynamin1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38663399
Proper citation: RRID:Addgene_198342 Copy
Species: Synthetic
Genetic Insert: Cal-ID
Vector Backbone Description: Backbone Size:9225; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38658655
Proper citation: RRID:Addgene_216628 Copy
Species: Homo sapiens
Genetic Insert: 4A8 variant Fab
Vector Backbone Description: Backbone Marker:Whitehead Lab, Addgene #81169; Vector Backbone:pETconNK; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38730230
Proper citation: RRID:Addgene_217832 Copy
Genetic Insert: hM4D(Gi)
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38636524
Proper citation: RRID:Addgene_209701 Copy
Species: Synthetic
Genetic Insert: Cal-ID-PM
Vector Backbone Description: Backbone Size:9225; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38658655
Proper citation: RRID:Addgene_216637 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
