Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGL4.23 C3_31 Resource Report Resource Website |
RRID:Addgene_60310 | SLC2A2 enhancer | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr3; start: 172177343 end: 172179831 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGTGTTTGAGCTCCCCTGAAA Rv primer used for cloning: TGGTGGTGGTTTGCTGAACCATGT | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
pGL4.23 C3_38 Resource Report Resource Website |
RRID:Addgene_60316 | ACSL1 enhancer | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr4; start: 185953054 end: 185954041 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCTCCCCACTATCCCAGAGGA Rv primer used for cloning: CTGGCAGGGTGCAAACATCAGC | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
pGL4.23 C5_12 Resource Report Resource Website |
RRID:Addgene_60319 | Non active element (nearest TSS C18orf26) | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr18; start: 50489292 end: 50489931 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCAGCCCTTGGTCAAGAATAGT Rv primer used for cloning: TGTAAGCGGTTTGGGCAATCTT | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
pGL4.23-GW Resource Report Resource Website 10+ mentions |
RRID:Addgene_60323 | Chloramphenicol and Ampicillin | PMID:24413736 | Gateway cassette was inserted between SacI and XhoI restriction sites in the MCS. | Backbone Marker:Promega; Backbone Size:4283; Vector Backbone:pGL4.23; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:17:31 | 12 | |||
|
pGL4.23 C5_14 Resource Report Resource Website |
RRID:Addgene_60321 | Non active element (nearest TSS CCRN4L) | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr4; start: 139931533 end: 139932029 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCATGGTCGGATATGACAGTTT Rv primer used for cloning: CCCATGGGAATAAGGCCTGTAGA | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
UASGAL-CU2-Pleum Resource Report Resource Website |
RRID:Addgene_60328 | promoter | Saccharomyces cerevisiae | Ampicillin | PMID:22565375 | Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | ||
|
Gal4pBS24-Pleum Resource Report Resource Website |
RRID:Addgene_60327 | promoter | Saccharomyces cerevisiae | Ampicillin | PMID:22565375 | Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | ||
|
pENTR D-TOPO-C3_39 Resource Report Resource Website |
RRID:Addgene_60280 | PCSK1 enhancer | Homo sapiens | Kanamycin | PMID:24413736 | chromosome : chr5; start: 95655454 end: 95657341 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGATCCACCAGCCTCAGTCTC Rv primer used for cloning: TGTGTGCATACATGATGCCCTTTG | Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:30 | 0 | |
|
pGL4.23 C2_10 Resource Report Resource Website |
RRID:Addgene_60287 | LINGO2 inactive enhancer | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr9; start: 29215891 end: 29216522 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCAGTGGGTTGTTTGTGTTTTT Rv primer used for cloning: TTGCTATGGTTAAGGTAAATGGCACA | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
Human-Dysferlin-v1 Resource Report Resource Website |
RRID:Addgene_60217 | Dysferlin | Homo sapiens | Kanamycin | Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:30 | 0 | |||
|
Mouse-Dysferlin-Transcript-Variant2 Resource Report Resource Website |
RRID:Addgene_60215 | Dysferlin | Mus musculus | Kanamycin | Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:30 | 0 | |||
|
pGL4.23 C2_14 Resource Report Resource Website |
RRID:Addgene_60290 | EDARADD inactive enhancer | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr1; start: 234595797 end: 234596272 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTTCTGCAATGTTTAATCTGC Rv primer used for cloning: GGTCTCAGCTCAGTGGTAGGG | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
pGL4.23 C3_8 Resource Report Resource Website |
RRID:Addgene_60294 | KIRREL3 enhancer | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr11; start: 126232858 end: 126233700 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGTGTGGGAGAAAAGTCTTCA Rv primer used for cloning: TGCCTTGTGAATGGCAGAGGAG | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
pGL4.23 C3_7 Resource Report Resource Website |
RRID:Addgene_60293 | SLC30A8 enhancer | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr8; start: 118326349 end: 118327201 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGGAGGTCAGAGTTGCCTACA Rv primer used for cloning: CATGGATTCAGGCCATTCCTGTCA | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
pGL4.23 C3_13 Resource Report Resource Website |
RRID:Addgene_60298 | EDN3 enhancer | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr20; start: 57374048 end: 57374748 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCATTCAGAAGCCCTTTCC Rv primer used for cloning: TTCTGCACCCAGCTTTGTAAGAGG | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
pGL4.23 C3_11 Resource Report Resource Website |
RRID:Addgene_60297 | CDKAL1 enhancer | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr6; start: 20799028 end: 20800286 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTGAGAGCGGATTTTACAGAT Rv primer used for cloning: AGCAAAAGCTGCCATGCCTA | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
pGL4.23 C3_21 Resource Report Resource Website |
RRID:Addgene_60296 | CDKN2BAS enhancer | Homo sapiens | Ampicillin | PMID:24413736 | chromosome : chr9; start: 22123613 end: 22124279 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTCTGCATAAATTCTTTGGAACA Rv primer used for cloning: GATCCACCCACCTTGGTTTCC | Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:31 | 0 | |
|
AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Resource Report Resource Website |
RRID:Addgene_60225 | sgRNA | Ampicillin | PMID:25263330 |
Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor |
Backbone Size:2738; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:30 | 0 | ||
|
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR Resource Report Resource Website 1+ mentions |
RRID:Addgene_60228 | sgRNA | Ampicillin | PMID:25263330 |
Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor |
Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:30 | 2 | ||
|
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR Resource Report Resource Website |
RRID:Addgene_60227 | sgRNA | Ampicillin | PMID:25263330 |
Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor |
Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:30 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.