Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pC1-HyPerRed-mito
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_60247 HyPerRed-mito Synthetic Kanamycin PMID:25330925 Backbone Size:3931; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 2
IMS-HyPer2
 
Resource Report
Resource Website
RRID:Addgene_60248 IMS-HyPer2 Synthetic Kanamycin PMID:25330925 Backbone Size:4000; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
Myopathy Loop Mutant Nuclear Myosin I YFP
 
Resource Report
Resource Website
RRID:Addgene_60243 Nuclear Myosin 1 Mus musculus Kanamycin PMID:16631592 Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Deleted I339, I340, G343, E344, E345,L346 2026-08-15 01:17:30 0
E407V Nuclear Myosin I YFP
 
Resource Report
Resource Website
RRID:Addgene_60242 Nuclear Myosin 1 Mus musculus Kanamycin PMID:16631592 Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin E407V 2026-08-15 01:17:30 0
pENTR D-TOPO-C3_9
 
Resource Report
Resource Website
RRID:Addgene_60258 NKX6-1 enhancer Homo sapiens Kanamycin PMID:24413736 chromosome : chr4; start: 85558293 end: 85558959 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACC AGAGAACAACAGGCAGGT Rv primer used for cloning: TCATTGAACTTCCCCGATGG Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
pENTR D-TOPO-C3_8
 
Resource Report
Resource Website
RRID:Addgene_60257 KIRREL3 enhancer Homo sapiens Kanamycin PMID:24413736 chromosome : chr11; start: 126232858 end: 126233700 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGTGTGGGAGAAAAGTCTTCA Rv primer used for cloning: TGCCTTGTGAATGGCAGAGGAG Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
pENTR D-TOPO-C3_7
 
Resource Report
Resource Website
RRID:Addgene_60256 SLC30A8 enhancer Homo sapiens Kanamycin PMID:24413736 chromosome : chr8; start: 118326349 end: 118327201 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGGAGGTCAGAGTTGCCTACA Rv primer used for cloning: CATGGATTCAGGCCATTCCTGTCA Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
pENTR D-TOPO-C3_5
 
Resource Report
Resource Website
RRID:Addgene_60254 WSCD2 enhancer Homo sapiens Kanamycin PMID:24413736 chromosome : chr12; start: 107010900 end: 107011629 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCCATCACCTGTGACCTTTT Rv primer used for cloning: ACAGGGGCTGGGCAACATTC Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
pENTR D-TOPO-C2_13
 
Resource Report
Resource Website
RRID:Addgene_60252 SPATA19 inactive enhancer Homo sapiens Kanamycin PMID:24413736 chromosome : chr11; start: 133163067 end: 133163569 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCGAAGGAGTCTGTTGTCAC Rv primer used for cloning: GCCCCTAAAATCAAGGCAATTGAG Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
pENTR D-TOPO-C2_11
 
Resource Report
Resource Website
RRID:Addgene_60251 SMYD3 inactive enhancer Homo sapiens Kanamycin PMID:24413736 chromosome : chr1; start: 244375383 end: 244375884 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCATCTGAGCTTCACTGGATT Rv primer used for cloning: TGAGTTTTGAAGTCAGACAGACCTGGA Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
pENTR D-TOPO-C3_26
 
Resource Report
Resource Website
RRID:Addgene_60269 OBFC2A enhancer Homo sapiens Kanamycin PMID:24413736 chromosome : chr2; start: 192035133 end: 192035929 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGCGCTGTATGCAAAGTGAGG Rv primer used for cloning: TGTCCCCAAAACTGCTCCCACA Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:31 0
pGL4.23 C3_19
 
Resource Report
Resource Website
RRID:Addgene_60302 THADA enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr2; start: 43564683 end: 43565659 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCAATCATCCCTCCACAAGAGT Rv primer used for cloning: GCAAGGTAGCAAGGGGTGAAATG Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_18
 
Resource Report
Resource Website
RRID:Addgene_60301 ZBED3 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr5; start: 76470322 end: 76471169 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCGCCTTTTCTACTTTGCCTA Rv primer used for cloning: TCCACTAGGAGTTTTGGAATGAGTGAA Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_22
 
Resource Report
Resource Website
RRID:Addgene_60304 ZMIZ1 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr10; start: 80613972 end: 80614474 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCCTCTGTCTTCCTTCCACCA Rv primer used for cloning: CACGGCTCCATTGGCATCTCC Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_29
 
Resource Report
Resource Website
RRID:Addgene_60309 ZFP36L2 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr2; start: 43451134 end: 43452137 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTGCTTATTTGAAAACATTTGA Rv primer used for cloning: CCCTCTCAACAAAAACTGAGCA Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_28
 
Resource Report
Resource Website
RRID:Addgene_60308 CRY2 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr11; start: 45836041 end: 45836866 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCTGTGCATGGCTAGGACATT Rv primer used for cloning: TCCCCATTCCTGTGGGGAGAG Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pGL4.23 C3_27
 
Resource Report
Resource Website
RRID:Addgene_60307 C16orf80 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr16; start: 56718269 end: 56718865 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCGGCCCCAAACTTTCCTTT Rv primer used for cloning: GGGCCCTCTGTGCCAGTGGAAT Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0
pENTR D-TOPO-C3_19
 
Resource Report
Resource Website
RRID:Addgene_60265 THADA enhancer Homo sapiens Kanamycin PMID:24413736 chromosome : chr2; start: 43564683 end: 43565659 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCAATCATCCCTCCACAAGAGT Rv primer used for cloning: GCAAGGTAGCAAGGGGTGAAATG Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
pENTR D-TOPO-C3_18
 
Resource Report
Resource Website
RRID:Addgene_60264 ZBED3 enhancer Homo sapiens Kanamycin PMID:24413736 chromosome : chr5; start: 76470322 end: 76471169 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCGCCTTTTCTACTTTGCCTA Rv primer used for cloning: TCCACTAGGAGTTTTGGAATGAGTGAA Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:17:30 0
pGL4.23 C3_33
 
Resource Report
Resource Website
RRID:Addgene_60312 GLIS3 enhancer Homo sapiens Ampicillin PMID:24413736 chromosome : chr9; start: 4279544 end: 4281151 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGACAGGATTCCATCGGAAGA Rv primer used for cloning: CCAACGTTAGGCCTTGGGAGTGC Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:17:31 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.