Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pSuper.Retro.Puro-WDR5 shRNA 2
 
Resource Report
Resource Website 		RRID:Addgene_59975 WDR5 shRNA Homo sapiens Ampicillin PMID:24793694 Backbone Marker:OligoEngine; Backbone Size:6349; Vector Backbone:pSuper.Retro.Puro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 0
p3XFLAG-CMV-14-WDR5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59974 WDR5 Homo sapiens Ampicillin PMID:24793694 Backbone Marker:Sigma-Aldrich; Backbone Size:6300; Vector Backbone:p3XFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:27 6
pcDNA3-mDIS3-FLAG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60046 DIS3 Mus musculus Ampicillin PMID:25175028 Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 1
pEF1-puro/hpb1
 
Resource Report
Resource Website 		RRID:Addgene_59976 human integrin b1 headpiece Homo sapiens Ampicillin Backbone Size:6000; Vector Backbone:pEF1-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:27 0
pCMX-PL1-WDR5
 
Resource Report
Resource Website 		RRID:Addgene_59970 WDR5 Homo sapiens Ampicillin PMID:24793694 Backbone Size:4500; Vector Backbone:pCMX-PL1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:27 0
pCI-FLAG-mTUT4
 
Resource Report
Resource Website 		RRID:Addgene_60041 TUT4 Mus musculus Ampicillin PMID:25175028 Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 0
pCI-FLAG-mRRP6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_60045 RRP6 Mus musculus Ampicillin PMID:25175028 Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 1
pcDNA3-FLAG-mTUT5
 
Resource Report
Resource Website 		RRID:Addgene_60042 TUT5 Mus musculus Ampicillin PMID:25175028 Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 0
pDCC5
 
Resource Report
Resource Website 		RRID:Addgene_59984 Cas9-D10A Synthetic Ampicillin PMID:25236734 Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin D10A 2026-08-15 01:17:28 0
pOTTC407 - pAAV EF1a eGFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_60058 enhanced Green Fluorescent Protein Other Ampicillin PMID:24746855 Backbone Marker:Christopher Richie / OTTC / NIDA; Vector Backbone:pOTTC374 - pAAV EF1a DIO iRFP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 10
Mesp-1916/-1>nls::Cas9::nls
 
Resource Report
Resource Website 		RRID:Addgene_59988 nls::Cas9::nls Streptococcus pyogenes Ampicillin PMID:25336740 Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83. Vector Backbone:pCESAx; Vector Types:CRISPR; Bacterial Resistance:Ampicillin Reverted mutations from dCas9 to wiltdtype 2026-08-15 01:17:27 0
Eef1a-1955/-1>nls::Cas9::nls
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59987 nls::Cas9::nls Streptococcus pyogenes Ampicillin PMID:25336740 Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83. Vector Backbone:pCESAx; Vector Types:CRISPR; Bacterial Resistance:Ampicillin Reverted mutations from dCas9 to wiltdtype 2026-08-15 01:17:28 4
Nanog-2A-mCherry
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_59995 Nanog Mus musculus Ampicillin PMID:23827708 Vector Backbone:PCR2_TOPO; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 10
pLT 652
 
Resource Report
Resource Website 		RRID:Addgene_59997 dhc-3 Caenorhabditis elegans Ampicillin PMID:25066299 Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.) Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin partial genomic 2026-08-15 01:17:28 0
pLT 653
 
Resource Report
Resource Website 		RRID:Addgene_59996 dhc-3 Caenorhabditis elegans Ampicillin PMID:25066299 Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.) Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin partial genomic 2026-08-15 01:17:28 0
Gal4pBS1-Pleum
 
Resource Report
Resource Website 		RRID:Addgene_59993 promoter Saccharomyces cerevisiae Ampicillin PMID:22565375 Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 0
Gal4pBS2-Pleum
 
Resource Report
Resource Website 		RRID:Addgene_59992 promoter Saccharomyces cerevisiae Ampicillin PMID:22565375 Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 0
RFN_EGFP_47
 
Resource Report
Resource Website 		RRID:Addgene_60071 pair of multiplex gRNAs targeting EGFP Ampicillin PMID:24770325 Left gRNA target site: AAGTTCAGCGTGTCCGGCGA Right gRNA target site: CCGTCCAGCTCGACCAGGAT Backbone Marker:Joung lab (Addgene plasmid # 53370); Vector Backbone:pSQT1313; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 0
GFP-CYLD-STOP
 
Resource Report
Resource Website 		RRID:Addgene_60077 Cylindromatosis Homo sapiens Ampicillin PMID:17495026 Backbone Marker:Life Technologies; Backbone Size:2600; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:28 0
pLPNPX1
 
Resource Report
Resource Website 		RRID:Addgene_60126 Ampicillin Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:29 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch