Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: WDR5 shRNA
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6349; Vector Backbone:pSuper.Retro.Puro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24793694
Proper citation: RRID:Addgene_59975 Copy
Species: Homo sapiens
Genetic Insert: WDR5
Vector Backbone Description: Backbone Marker:Sigma-Aldrich; Backbone Size:6300; Vector Backbone:p3XFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24793694
Proper citation: RRID:Addgene_59974 Copy
Species: Mus musculus
Genetic Insert: DIS3
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25175028
Proper citation: RRID:Addgene_60046 Copy
Species: Homo sapiens
Genetic Insert: human integrin b1 headpiece
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEF1-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_59976 Copy
Species: Homo sapiens
Genetic Insert: WDR5
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX-PL1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24793694
Proper citation: RRID:Addgene_59970 Copy
Species: Mus musculus
Genetic Insert: TUT4
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25175028
Proper citation: RRID:Addgene_60041 Copy
Species: Mus musculus
Genetic Insert: RRP6
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25175028
Proper citation: RRID:Addgene_60045 Copy
Species: Mus musculus
Genetic Insert: TUT5
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25175028
Proper citation: RRID:Addgene_60042 Copy
Species: Synthetic
Genetic Insert: Cas9-D10A
Vector Backbone Description: Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25236734
Proper citation: RRID:Addgene_59984 Copy
Species: Other
Genetic Insert: enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Marker:Christopher Richie / OTTC / NIDA; Vector Backbone:pOTTC374 - pAAV EF1a DIO iRFP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24746855
Proper citation: RRID:Addgene_60058 Copy
Species: Streptococcus pyogenes
Genetic Insert: nls::Cas9::nls
Vector Backbone Description: Vector Backbone:pCESAx; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25336740
Comments: Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83.
Proper citation: RRID:Addgene_59988 Copy
Species: Streptococcus pyogenes
Genetic Insert: nls::Cas9::nls
Vector Backbone Description: Vector Backbone:pCESAx; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25336740
Comments: Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83.
Proper citation: RRID:Addgene_59987 Copy
Species: Mus musculus
Genetic Insert: Nanog
Vector Backbone Description: Vector Backbone:PCR2_TOPO; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23827708
Proper citation: RRID:Addgene_59995 Copy
Species: Caenorhabditis elegans
Genetic Insert: dhc-3
Vector Backbone Description: Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25066299
Comments: Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.)
Proper citation: RRID:Addgene_59997 Copy
Species: Caenorhabditis elegans
Genetic Insert: dhc-3
Vector Backbone Description: Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25066299
Comments: Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.)
Proper citation: RRID:Addgene_59996 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22565375
Proper citation: RRID:Addgene_59993 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22565375
Proper citation: RRID:Addgene_59992 Copy
Genetic Insert: pair of multiplex gRNAs targeting EGFP
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid # 53370); Vector Backbone:pSQT1313; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24770325
Comments: Left gRNA target site: AAGTTCAGCGTGTCCGGCGA
Right gRNA target site: CCGTCCAGCTCGACCAGGAT
Proper citation: RRID:Addgene_60071 Copy
Species: Homo sapiens
Genetic Insert: Cylindromatosis
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:2600; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17495026
Proper citation: RRID:Addgene_60077 Copy
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_60126 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
