Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 204 showing 4061 ~ 4080 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/59975

Species: Homo sapiens
Genetic Insert: WDR5 shRNA
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6349; Vector Backbone:pSuper.Retro.Puro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24793694

Proper citation: RRID:Addgene_59975 Copy   


  • RRID:Addgene_59974

    This resource has 1+ mentions.

http://www.addgene.org/59974

Species: Homo sapiens
Genetic Insert: WDR5
Vector Backbone Description: Backbone Marker:Sigma-Aldrich; Backbone Size:6300; Vector Backbone:p3XFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24793694

Proper citation: RRID:Addgene_59974 Copy   


  • RRID:Addgene_60046

    This resource has 1+ mentions.

http://www.addgene.org/60046

Species: Mus musculus
Genetic Insert: DIS3
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25175028

Proper citation: RRID:Addgene_60046 Copy   


  • RRID:Addgene_59976

http://www.addgene.org/59976

Species: Homo sapiens
Genetic Insert: human integrin b1 headpiece
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEF1-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_59976 Copy   


  • RRID:Addgene_59970

http://www.addgene.org/59970

Species: Homo sapiens
Genetic Insert: WDR5
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX-PL1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24793694

Proper citation: RRID:Addgene_59970 Copy   


  • RRID:Addgene_60041

http://www.addgene.org/60041

Species: Mus musculus
Genetic Insert: TUT4
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25175028

Proper citation: RRID:Addgene_60041 Copy   


  • RRID:Addgene_60045

    This resource has 1+ mentions.

http://www.addgene.org/60045

Species: Mus musculus
Genetic Insert: RRP6
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25175028

Proper citation: RRID:Addgene_60045 Copy   


  • RRID:Addgene_60042

http://www.addgene.org/60042

Species: Mus musculus
Genetic Insert: TUT5
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25175028

Proper citation: RRID:Addgene_60042 Copy   


  • RRID:Addgene_59984

http://www.addgene.org/59984

Species: Synthetic
Genetic Insert: Cas9-D10A
Vector Backbone Description: Vector Backbone:pHW; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25236734

Proper citation: RRID:Addgene_59984 Copy   


  • RRID:Addgene_60058

    This resource has 10+ mentions.

http://www.addgene.org/60058

Species: Other
Genetic Insert: enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Marker:Christopher Richie / OTTC / NIDA; Vector Backbone:pOTTC374 - pAAV EF1a DIO iRFP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24746855

Proper citation: RRID:Addgene_60058 Copy   


http://www.addgene.org/59988

Species: Streptococcus pyogenes
Genetic Insert: nls::Cas9::nls
Vector Backbone Description: Vector Backbone:pCESAx; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25336740
Comments: Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83.

Proper citation: RRID:Addgene_59988 Copy   


  • RRID:Addgene_59987

    This resource has 1+ mentions.

http://www.addgene.org/59987

Species: Streptococcus pyogenes
Genetic Insert: nls::Cas9::nls
Vector Backbone Description: Vector Backbone:pCESAx; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25336740
Comments: Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83.

Proper citation: RRID:Addgene_59987 Copy   


  • RRID:Addgene_59995

    This resource has 10+ mentions.

http://www.addgene.org/59995

Species: Mus musculus
Genetic Insert: Nanog
Vector Backbone Description: Vector Backbone:PCR2_TOPO; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23827708

Proper citation: RRID:Addgene_59995 Copy   


  • RRID:Addgene_59997

http://www.addgene.org/59997

Species: Caenorhabditis elegans
Genetic Insert: dhc-3
Vector Backbone Description: Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25066299
Comments: Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.)

Proper citation: RRID:Addgene_59997 Copy   


  • RRID:Addgene_59996

http://www.addgene.org/59996

Species: Caenorhabditis elegans
Genetic Insert: dhc-3
Vector Backbone Description: Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25066299
Comments: Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.)

Proper citation: RRID:Addgene_59996 Copy   


  • RRID:Addgene_59993

http://www.addgene.org/59993

Species: Saccharomyces cerevisiae
Genetic Insert: promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22565375

Proper citation: RRID:Addgene_59993 Copy   


  • RRID:Addgene_59992

http://www.addgene.org/59992

Species: Saccharomyces cerevisiae
Genetic Insert: promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22565375

Proper citation: RRID:Addgene_59992 Copy   


  • RRID:Addgene_60071

http://www.addgene.org/60071

Genetic Insert: pair of multiplex gRNAs targeting EGFP
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid # 53370); Vector Backbone:pSQT1313; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24770325
Comments: Left gRNA target site: AAGTTCAGCGTGTCCGGCGA Right gRNA target site: CCGTCCAGCTCGACCAGGAT

Proper citation: RRID:Addgene_60071 Copy   


  • RRID:Addgene_60077

http://www.addgene.org/60077

Species: Homo sapiens
Genetic Insert: Cylindromatosis
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:2600; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17495026

Proper citation: RRID:Addgene_60077 Copy   


  • RRID:Addgene_60126

http://www.addgene.org/60126

Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_60126 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X