Plasmids   Select Another Resource Report Type

http://www.addgene.org/38066

Species: Homo sapiens
Genetic Insert: HNRNPD heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
Vector Backbone Description: Backbone Size:5496; Vector Backbone:pFRT/TO/HIS/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22681889

Proper citation: RRID:Addgene_38066 Copy   

•   Source: Addgene

http://www.addgene.org/37938

Species: H. Herpesvirus 4 (EBV)
Genetic Insert: BILF1
Vector Backbone Description: Backbone Size:8162; Vector Backbone:MSCV-N FLAGHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22810586
Comments: Note that the Gateway cloning reaction has left several vector-based nucleotides in frame with the 3' end of the insert, leaving additional amino acid residues [PTFLYKVVR] fused to the C-terminus of translated protein.

Proper citation: RRID:Addgene_37938 Copy   

•   Source: Addgene

http://www.addgene.org/38057

Genetic Insert: tTA
Vector Backbone Description: Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15580589
Comments: Adenoviral plasmid for overexpression of tet transactivator (tTA) from CMV promoter with WPRE. Additional reference information for this plasmid can be found at: https://www.ncbi.nlm.nih.gov/pubmed/15542617

Proper citation: RRID:Addgene_38057 Copy   

•   Source: Addgene

http://www.addgene.org/38059

Genetic Insert: tTA
Vector Backbone Description: Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15580589
Comments: Adenoviral plasmid for overexpression of tet transactivator (tTA) from Synapsin promoter with WPRE. Additional reference information for this plasmid can be found at: https://www.ncbi.nlm.nih.gov/pubmed/15542617

Proper citation: RRID:Addgene_38059 Copy   

•   Source: Addgene

http://www.addgene.org/38054

Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11991741
Comments: Adenoviral plasmid for overexpression of EGFP from synapsin promoter

Proper citation: RRID:Addgene_38054 Copy   

•   Source: Addgene

http://www.addgene.org/38060

Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15580589
Comments: Adenoviral plasmid for overexpression of EGFP from tetracycline responsive element (TRE), intended to be used in conjucntion with one of the plasmids expressing tet transactivator (tTA), such as Addgene plasmid #'s 38056, 38057, 38058 or 38059. Additional reference information for this plasmid can be found at: https://www.ncbi.nlm.nih.gov/pubmed/15542617

Proper citation: RRID:Addgene_38060 Copy   

•   Source: Addgene

http://www.addgene.org/38047

Species: Human adenovirus 5
Genetic Insert: E1B 19K
Vector Backbone Description: Backbone Size:8162; Vector Backbone:MSCV-N FLAGHA; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22810586
Comments: Note that the Gateway cloning reaction has left several vector-based nucleotides in frame with the 3' end of the insert, adding several amino acid residues [STFLYKVVR] fused to the C-terminus of translated protein.

Proper citation: RRID:Addgene_38047 Copy   

•   Source: Addgene

http://www.addgene.org/38041

Vector Backbone Description: Backbone Marker:Masatoshi Takeichi; Backbone Size:4839; Vector Backbone:CA-MCS; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22681690

Proper citation: RRID:Addgene_38041 Copy   

•   Source: Addgene

http://www.addgene.org/38044

Species: Synthetic
Genetic Insert: Avian sarcoma and leukemia virus receptor 950
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:5604; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22681690

Proper citation: RRID:Addgene_38044 Copy   

•   Source: Addgene

http://www.addgene.org/38050

Species: Rattus norvegicus
Genetic Insert: CREB
Vector Backbone Description: Vector Backbone:pXCXCMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15129168
Comments: Adenoviral plasmid for overexpression of CREB from CMV promoter

Proper citation: RRID:Addgene_38050 Copy   

•   Source: Addgene

http://www.addgene.org/38159

Species: Homo sapiens
Genetic Insert: BCR/ABL P190
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18070886
Comments: Constructed by Suparna Mishra. Generated in a 3-way ligation consisting of 5' 0.75 kb BamHI/Sal I + 3' 6.3 kb Sal I/EcoRI BCR/ABL fragments into pLEF digested with BamHIxEcoRI. The ABL part of the insert contains the natural TAG and 3' UT sequences. Addgene NGS identified a sequence discrepancy at nucleotide 3168 resulting in a T117M mutation in the ABL-1 sequence, relative to Genbank ID NP_005148.2 and Addgene Plasmid #38158. This is not a known polymorphism and the effect of this, if any, on the protein is not known.

Proper citation: RRID:Addgene_38159 Copy   

•   Source: Addgene

http://www.addgene.org/38155

Species: Homo sapiens
Genetic Insert: Abr
Vector Backbone Description: Backbone Marker:Don Kohn [email protected]; Backbone Size:6600; Vector Backbone:pCCL-cppt178-MNDU3; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17116687
Comments: Constructed by Jess Cunnick. Abr was first subcloned into pEYFP-C1 Bgl II x KpnI as a 0.4 kb 5' BamHI/BstEII + 2.2 kb BstEII- KpnI fragment. The EYFP-Abr fusion was isolated as a 5' AgeI- 3' KpnI fragment and inserted into pCCL-cppt178-MNDU3-X3 digested with Xma I x Kpn I.

Proper citation: RRID:Addgene_38155 Copy   

•   Source: Addgene

http://www.addgene.org/38157

Species: Homo sapiens
Genetic Insert: ABR
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18070886
Comments: Constructed by Suparna Mishra. Generated in a 3-way ligation consisting of 5' 0.4 kb BamHI/BstEII + 3' 2.2 kb BstEII/EcoRI ABR fragments into pLEF digested with BamHIxEcoRI. The ABR insert contains the natural TAG and 3' UT sequences. Addgene sequencing found an E24G point mutation--this does not alter plasmid function.

Proper citation: RRID:Addgene_38157 Copy   

•   Source: Addgene

http://www.addgene.org/38160

Species: Homo sapiens
Genetic Insert: Bcr
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pLEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14614449
Comments: Constructed by Anja Reichert. Generated in a 3-way ligation consisting of 5' 0.6 kb BamHI/SalI + 3' 3.5 kb SalI/XbaI BCR fragments into pLEF digested with BamHIxXbaI. The BCR insert contains the natural TAG and 3' UT sequences. At the 3' end there are polylinker sequences from pSK.

Proper citation: RRID:Addgene_38160 Copy   

•   Source: Addgene

http://www.addgene.org/38161

Species: Homo sapiens
Genetic Insert: Bcr/Abl P210
Vector Backbone Description: Backbone Marker:Pharmingen; Backbone Size:8530; Vector Backbone:pAcG2T; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: Constructed by Nora Heisterkamp. Made using a 3-way ligation with 0.6 kb 5' BamHI-SalI from BCR + 3' 7.5 kb Sal I-EcoRI into pAcG2T. Not evaluated for protein production.

Proper citation: RRID:Addgene_38161 Copy   

•   Source: Addgene

http://www.addgene.org/38149

Species: Caenorhabditis elegans
Genetic Insert: cbr-unc-119::FRT*::galk::FRT*
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression, recombineering; Bacterial Resistance:Ampicillin
Comments: This plasmid carries a complementary cassette consisting of a genomic copy of the C. briggsae unc-119 gene and the selectable galK marker flanked by FRT* sites in the presumptive 3’ UTR of the Cbr-unc-119 gene. The 3.6 kb Cbr-unc-119::FRT*::galk::FRT* cassette can be targeted by recombineering to insert between nts 281:282 in the pCC1FOS fosmid vector backbone. In other words, this cassette can be readily inserted in all fosmids contained in the C. elegans library developed by Don Moerman and colleagues. We have tested the construct in fosmid recombineering and have shown that it rescues unc-119(ed3) mutants.

Proper citation: RRID:Addgene_38149 Copy   

•   Source: Addgene

http://www.addgene.org/38145

Species: Caenorhabditis elegans
Genetic Insert: ptc-3::GFP
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21215260
Comments: The pPK348 plasmid was derived by inserting the GFP cassette from pPD103.87 (Addgene plasmid 1524) flanked by XbaI ends into the unique SpeI site present in exon 8 of ptc-3 and carries the entire predicted ptc-3 locus comprised of a 6.9 kb genomic coding region fused in-frame to GFP and more than 5 kb of 5′ upstream sequence, including the putative promoter Please note that Addgene's sequencing results identified several mismatches in the region of bp#722-824 when compared to the full plasmid sequence provided by the depositing laboratory. The depositor states that these mismatches are not a concern for the function of the plasmid.

Proper citation: RRID:Addgene_38145 Copy   

•   Source: Addgene

http://www.addgene.org/38146

Species: Caenorhabditis elegans
Genetic Insert: let-60p::ptc-3::gfp
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KSII(+); Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21215260
Comments: The pPK700 plasmid was derived by ligating the let-60 promoter region to ptc-3::gfp expression cassette, which was PCR amplified from pPK348 (Addgene plasmid 38145)

Proper citation: RRID:Addgene_38146 Copy   

•   Source: Addgene

http://www.addgene.org/38142

Species: Synthetic
Genetic Insert: GoldyTALEN
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pBSK; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23027955
Comments: Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer. The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid. For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899). For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson

Proper citation: RRID:Addgene_38142 Copy   

•   Source: Addgene

http://www.addgene.org/38143

Species: Synthetic
Genetic Insert: GoldyTALEN
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pBSK; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23027955
Comments: For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899). For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson

Proper citation: RRID:Addgene_38143 Copy   

•   Source: Addgene