Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

742,877 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
LSB-hsa-miR-744-3p
 
Resource Report
Resource Website 		RRID:Addgene_103726 hsa-miR-744-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-09-12 02:14:02 0
LSB-hsa-miR-708-5p
 
Resource Report
Resource Website 		RRID:Addgene_103725 hsa-miR-708-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-09-12 02:14:02 0
LSB-hsa-miR-675-3p
 
Resource Report
Resource Website 		RRID:Addgene_103720 hsa-miR-675-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-09-12 02:14:02 0
LSB-hsa-miR-7-1-3p
 
Resource Report
Resource Website 		RRID:Addgene_103722 hsa-miR-7-1-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-09-12 02:14:02 0
LSB-hsa-miR-675-5p
 
Resource Report
Resource Website 		RRID:Addgene_103721 hsa-miR-675-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-09-12 02:14:02 0
pCIBN-mCherry
 
Resource Report
Resource Website 		RRID:Addgene_103816 CIBN Arabidopsis thaliana Kanamycin PMID:29122982 Backbone Marker:Clontech; Backbone Size:4672; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:14:02 0
pCIBN-EYFP
 
Resource Report
Resource Website 		RRID:Addgene_103815 CIBN Arabidopsis thaliana Kanamycin PMID:29122982 Backbone Marker:Clontech; Backbone Size:4725; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:14:02 0
pPHR-iRFP713
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_103818 PHR-iRFP713 Arabidopsis thaliana Kanamycin PMID:29122982 Switched iRFP713 (PCR on Addgene #31857) for mCherry in pCRY2PHR-mCherry-N1 (Addgene #26866) using AgeI & NotI (AgeI site destroyed) Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:14:03 1
pPHR-EYFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_103817 PHR-EYFP Arabidopsis thaliana Kanamycin PMID:29122982 Switched EYFP for mCherry in pCRY2PHR-mCherry-N1 (Addgene #26866) Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:14:02 1
pCIBN-hTRF2-tagRFP-T
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_103812 CIBN-hTRF2-tagRFP-T Homo sapiens Kanamycin PMID:29122982 EGFP was cut out from the backbone (NheI/BamHI cuts) Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin hTRF2: deletion of amino acids 1-42 and 476 compared to NP_005643.2 2026-09-12 02:14:02 1
YFP-SspBx6
 
Resource Report
Resource Website 		RRID:Addgene_103778 YFP-SspBx6 Synthetic Kanamycin PMID:29115293 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:14:02 0
pCIBN-hTRF1-tagRFP-T
 
Resource Report
Resource Website 		RRID:Addgene_103811 CIBN-hTRF1-tagRFP-T Homo sapiens Kanamycin PMID:29122982 EGFP was cut out from the backbone (NheI/BamHI cuts) Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:14:02 0
pCIBN-LacI
 
Resource Report
Resource Website 		RRID:Addgene_103814 CIBN-LacI Arabidopsis thaliana Kanamycin PMID:29122982 EGFP was cut out from the backbone (NheI/BamHI cuts); relevance of mutations unknown Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin LacI: C19T (silent, L7L), T264C (silent, A88A), C370A (L124I), C404T (T135I), A417T (silent, A139A), G424A (A142T), T465A (silent, T155T) 2026-09-12 02:14:02 0
pPHR-EYFP-hGCN5
 
Resource Report
Resource Website 		RRID:Addgene_103826 PHR-EYFP-hGCN5 Homo sapiens Kanamycin PMID:29122982 mCherry was cut out from the backbone (XhoI/XbaI cuts); relevance of mutations unknown; amplified by PCR from Addgene #14106 Backbone Marker:Clontech; Backbone Size:3935; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin hGCN5: A566G (E189G), G585T (K195N), G726A (silent, K242K) 2026-09-12 02:14:03 0
pPHR-EYFP-hHP1β
 
Resource Report
Resource Website 		RRID:Addgene_103829 PHR-EYFP-hHP1β Homo sapiens Kanamycin PMID:29122982 mCherry was cut out from the backbone (XhoI/XbaI cuts) Backbone Marker:Clontech; Backbone Size:3935; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:14:03 0
TIA1 RRM-mCherry-iLIDx6
 
Resource Report
Resource Website 		RRID:Addgene_103782 TIA1 RRM-mCherry-iLIDx6 Synthetic Kanamycin PMID:29115293 Backbone Marker:Clontech; Backbone Size:4717; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:14:02 0
pMT2 TIA1 RRM-CFP-FRBx5
 
Resource Report
Resource Website 		RRID:Addgene_103783 TIA1 RRM-CFP-FRBx5 Synthetic Ampicillin PMID:29115293 Backbone Marker:Unknown; Backbone Size:5100; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:14:02 0
pPHR-iRFP713-NLS-VP16
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_103823 PHR-iRFP713-VP16 Arabidopsis thaliana Kanamycin PMID:29122982 aa412-482 of UL48 (transactivation domain); mCherry was cut out from the backbone (XhoI/NotI cuts) Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin VP16: G126T (silent, G42G) 2026-09-12 02:14:03 2
pPHR-EYFP-hPMLIII
 
Resource Report
Resource Website 		RRID:Addgene_103825 PHR-EYFP-hPMLIII Homo sapiens Kanamycin PMID:29122982 mCherry was cut out from the backbone (XhoI/XbaI cuts) Backbone Marker:Clontech; Backbone Size:3935; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:14:03 0
pPHR-mCherry-hPMLIII
 
Resource Report
Resource Website 		RRID:Addgene_103824 PHR-mCherry-hPMLIII Homo sapiens Kanamycin PMID:29122982 mCherry was cut out from the backbone (XhoI/NotI cuts) and reinserted with the insert Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:14:03 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

NIDDK Early Research Partnership Engagement Challenge

Funding Opportunity: National NIH K12 DiabDocs Career Development Program

NIH Data Sharing and Reuse Seminar- Sex Differences in Acute Kidney Injury Risk and Outcomes: Insights from MIMIC-III and MIMIC-IV

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch