Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: hsa-miR-675-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103720 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-7-1-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103722 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-675-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.
Proper citation: RRID:Addgene_103721 Copy
Species: Arabidopsis thaliana
Genetic Insert: CIBN
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4672; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Proper citation: RRID:Addgene_103816 Copy
Species: Arabidopsis thaliana
Genetic Insert: CIBN
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4725; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Proper citation: RRID:Addgene_103815 Copy
Species: Arabidopsis thaliana
Genetic Insert: PHR-iRFP713
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: Switched iRFP713 (PCR on Addgene #31857) for mCherry in pCRY2PHR-mCherry-N1 (Addgene #26866) using AgeI & NotI (AgeI site destroyed)
Proper citation: RRID:Addgene_103818 Copy
Species: Arabidopsis thaliana
Genetic Insert: PHR-EYFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: Switched EYFP for mCherry in pCRY2PHR-mCherry-N1 (Addgene #26866)
Proper citation: RRID:Addgene_103817 Copy
Species: Homo sapiens
Genetic Insert: CIBN-hTRF2-tagRFP-T
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: EGFP was cut out from the backbone (NheI/BamHI cuts)
Proper citation: RRID:Addgene_103812 Copy
Species: Synthetic
Genetic Insert: YFP-SspBx6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29115293
Proper citation: RRID:Addgene_103778 Copy
Species: Homo sapiens
Genetic Insert: CIBN-hTRF1-tagRFP-T
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: EGFP was cut out from the backbone (NheI/BamHI cuts)
Proper citation: RRID:Addgene_103811 Copy
Species: Arabidopsis thaliana
Genetic Insert: CIBN-LacI
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: EGFP was cut out from the backbone (NheI/BamHI cuts); relevance of mutations unknown
Proper citation: RRID:Addgene_103814 Copy
Species: Homo sapiens
Genetic Insert: PHR-EYFP-hGCN5
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3935; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: mCherry was cut out from the backbone (XhoI/XbaI cuts); relevance of mutations unknown; amplified by PCR from Addgene #14106
Proper citation: RRID:Addgene_103826 Copy
Species: Homo sapiens
Genetic Insert: PHR-EYFP-hHP1β
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3935; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: mCherry was cut out from the backbone (XhoI/XbaI cuts)
Proper citation: RRID:Addgene_103829 Copy
Species: Synthetic
Genetic Insert: TIA1 RRM-mCherry-iLIDx6
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4717; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29115293
Proper citation: RRID:Addgene_103782 Copy
Species: Synthetic
Genetic Insert: TIA1 RRM-CFP-FRBx5
Vector Backbone Description: Backbone Marker:Unknown; Backbone Size:5100; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29115293
Proper citation: RRID:Addgene_103783 Copy
Species: Arabidopsis thaliana
Genetic Insert: PHR-iRFP713-VP16
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: aa412-482 of UL48 (transactivation domain); mCherry was cut out from the backbone (XhoI/NotI cuts)
Proper citation: RRID:Addgene_103823 Copy
Species: Homo sapiens
Genetic Insert: PHR-EYFP-hPMLIII
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3935; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: mCherry was cut out from the backbone (XhoI/XbaI cuts)
Proper citation: RRID:Addgene_103825 Copy
Species: Homo sapiens
Genetic Insert: PHR-mCherry-hPMLIII
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: mCherry was cut out from the backbone (XhoI/NotI cuts) and reinserted with the insert
Proper citation: RRID:Addgene_103824 Copy
Species: Arabidopsis thaliana
Genetic Insert: PHR-mCherry-VP16
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: aa412-482 of UL48 (transactivation domain); mCherry was cut out from the backbone (XhoI/NotI cuts) and reinserted with the insert
Proper citation: RRID:Addgene_103821 Copy
Species: Arabidopsis thaliana
Genetic Insert: PHR-EYFP-NLS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29122982
Comments: Switched EYFP for mCherry in pCRY2PHR-mCherry-N1 (Addgene #26866) and inserted NLS by PCR
Proper citation: RRID:Addgene_103820 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.