Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: eIF5B
Vector Backbone Description: Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17913637
Proper citation: RRID:Addgene_37221 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HHtRNA
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637
Comments: HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG
Proper citation: RRID:Addgene_37222 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: eIF1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637
Proper citation: RRID:Addgene_37217 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: eIF5
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637
Proper citation: RRID:Addgene_37219 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HRC1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040
Proper citation: RRID:Addgene_37233 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yHse1-UIM (150-190)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST-parallel.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20150893
Proper citation: RRID:Addgene_44429 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Vps27-VHS (2-150)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20150893
Proper citation: RRID:Addgene_44417 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PGal1-D12 promoter
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4274; Vector Backbone:pRS404; Vector Types:Yeast Expression, Synthetic Biology, Expression regulator/reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19279212
Proper citation: RRID:Addgene_44515 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PGal1-T123 promoter
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4274; Vector Backbone:pRS404; Vector Types:Yeast Expression, Synthetic Biology, Expression regulator/reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19279212
Proper citation: RRID:Addgene_44514 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PGal1-D12 promoter
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4456; Vector Backbone:pRS403; Vector Types:Yeast Expression, Synthetic Biology, Expression regulator/reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19279212
Proper citation: RRID:Addgene_44516 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PGal1-D12 promoter
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4274; Vector Backbone:pRS404; Vector Types:Yeast Expression, Synthetic Biology, Expression regulator/reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19279212
Proper citation: RRID:Addgene_44508 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HA-htz1
Vector Backbone Description: Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16543223
Proper citation: RRID:Addgene_44549 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SIR2-6xHis
Vector Backbone Description: Vector Backbone:pET-24a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17889663
Proper citation: RRID:Addgene_44533 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HHF2
Vector Backbone Description: Vector Backbone:pTSB1-1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3046933
Proper citation: RRID:Addgene_44535 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL1-HHF2
Vector Backbone Description: Vector Backbone:pTSB1-1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3046933
Proper citation: RRID:Addgene_44534 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HHT2
Vector Backbone Description: Vector Backbone:pLJ999T; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1505519
Proper citation: RRID:Addgene_44526 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: P(GAL10)-HHT2 P(GAL1)-HHF2
Vector Backbone Description: Vector Backbone:pUK420; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1505519
Proper citation: RRID:Addgene_44525 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HHF2-HHT2
Vector Backbone Description: Vector Backbone:pRS314-B; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1505519
Proper citation: RRID:Addgene_44528 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HHT2
Vector Backbone Description: Vector Backbone:pLJ999T; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1505519
Proper citation: RRID:Addgene_44527 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HHF2-HHT2
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1505519
Proper citation: RRID:Addgene_44529 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
