Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: human GLIS1
Vector Backbone Description: Backbone Size:10184; Vector Backbone:pCXLE-gw; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23193063
Proper citation: RRID:Addgene_37625 Copy
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through
Proper citation: RRID:Addgene_37505 Copy
Vector Backbone Description: Backbone Size:5693; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8R adds a TEV-cleavable strep tag to the N-terminus of your protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ .
Proper citation: RRID:Addgene_37506 Copy
Vector Backbone Description: Backbone Marker:Andrew Fire (Addgene plasmid # 1494); Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22022276
Proper citation: RRID:Addgene_37464 Copy
Species: HPV
Genetic Insert: HPV 8E6
Vector Backbone Description: Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Comments: The 8E6 template was given to us by Harold Pfister who originally cloned the HPV8 genome. (J. Virology 1986, Pfister H. et al.)
Proper citation: RRID:Addgene_37460 Copy
Species: Homo sapiens
Genetic Insert: NLRC5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22490867
Proper citation: RRID:Addgene_37509 Copy
Species: HPV
Genetic Insert: HPV 6bE6
Vector Backbone Description: Backbone Size:6550; Vector Backbone:CMV bam neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Proper citation: RRID:Addgene_37457 Copy
Genetic Insert: Histone, 2A element, rabies B19 glycoprotein
Vector Backbone Description: Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please note that there are 2 mutations in Histone, D26G and V119I. These mutations should not affect plasmid function.
Proper citation: RRID:Addgene_37452 Copy
Species: E. coli
Genetic Insert: CsrA
Vector Backbone Description: Backbone Marker:Lim Lab; Vector Backbone:pZ with p15a origin; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23878244
Proper citation: RRID:Addgene_37571 Copy
Species: HPV
Genetic Insert: HPV 5E6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Proper citation: RRID:Addgene_37449 Copy
Species: Homo sapiens
Genetic Insert: E6AP III
Vector Backbone Description: Backbone Size:7800; Vector Backbone:PHAGE-P CMVt N-HA GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22645313
Proper citation: RRID:Addgene_37605 Copy
Species: HPV
Genetic Insert: HPV 16E6no*
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Proper citation: RRID:Addgene_37445 Copy
Species: A. victoria
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Lim Lab; Vector Backbone:pZ with ColE origin; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23878244
Proper citation: RRID:Addgene_37566 Copy
Species: HPV
Genetic Insert: HPV 6bE6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Proper citation: RRID:Addgene_37447 Copy
Species: Homo sapiens
Genetic Insert: MET
Vector Backbone Description: Backbone Marker:Eric Campeau Addgene Plasmid 17448; Backbone Size:8608; Vector Backbone:pLentiCMV GFP Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_37561 Copy
Species: Homo sapiens
Genetic Insert: MET
Vector Backbone Description: Backbone Marker:Eric Campeau Addgene Plasmid 17448; Backbone Size:8608; Vector Backbone:pLentiCMV GFP Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_37560 Copy
Species: Homo sapiens
Genetic Insert: Myc
Vector Backbone Description: Backbone Size:8344; Vector Backbone:pHAGE-B CMV N-EGFP GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22645313
Proper citation: RRID:Addgene_37608 Copy
Species: N/A
Genetic Insert: PreScission protease cleavage site-S tag-TEV site-Z
Vector Backbone Description: Backbone Size:6515; Vector Backbone:pSY07; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22431751
Proper citation: RRID:Addgene_37558 Copy
Species: HPV
Genetic Insert: HPV 8E6
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pB-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Proper citation: RRID:Addgene_37438 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Met3p-mCherry-Tub1
Vector Backbone Description: Backbone Size:4381; Vector Backbone:pRS306; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21294277
Proper citation: RRID:Addgene_37554 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
