Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pAT253
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40943 GFP-LacI** E. coli Ampicillin PMID:21724830 The plasmid pAFS135 (Straight, Sedat, and Murray, 1998) contains GFP(S65T, V163A)-LacI(P3Y, del C-terminal 11 aa)-SV40 NLS under the control of a HIS3 promoter fragment. To construct pAT123, the HIS3 marker of AFS135 was replaced with a ScaI-DraIII fragment from RS405 containing LEU2 (a kind gift from Karine Dubrana and Susan Gasser). The plasmid pAT222 (Addgene plasmid #40942) was obtained by site-directed mutagenesis of pAT123 to create GFP-LacI**, using the primers (base mutations in lowercase): 5’- GTGGCACAgCAACTGGCGGaCAAAggtggcggaTCGTTGCTGATTGGCGTTGCCtCCT-3’ and 5’- AGGaGGCAACGCCAATCAGCAACGAtccgccaccTTTGtCCGCCAGTTGcTGTGCCAC- 3’. The LacI** variant was then subcloned into pAFS135 using NotI and XhoI restriction sites to create plasmid pAT253. Backbone Marker:Andrew W. Murray Lab, UCSF (Straight, Sedat, & Murray, 1998. PMID: 9813090); Backbone Size:4600; Vector Backbone:pAFS135; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin LacI**/LacI2G(4 mutations) (see comment below); lacI-I12 mutation (P3Y); C-terminal 11 amino acids deleted to prevent tetramerization 2026-08-15 01:14:40 1
pCMV5-Flag-EPLIN alpha delta domain 7
 
Resource Report
Resource Website 		RRID:Addgene_40940 EPLIN alpha delta Domain 7 Homo sapiens Ampicillin PMID:11950948 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 562-600 2026-08-15 01:14:40 0
pCMV5-Flag-EPLIN alpha delta N112
 
Resource Report
Resource Website 		RRID:Addgene_40935 EPLIN Homo sapiens Ampicillin PMID:11950948 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-112 2026-08-15 01:14:40 0
pCMV5-Flag-EPLIN alpha delta N54
 
Resource Report
Resource Website 		RRID:Addgene_40934 EPLIN Homo sapiens Ampicillin PMID:11950948 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-54 2026-08-15 01:14:40 0
pCMV5-Flag-EPLIN alpha delta LIM
 
Resource Report
Resource Website 		RRID:Addgene_40933 EPLIN alpha Homo sapiens Ampicillin PMID:11950948 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin LIM domain deleted- amino acids 221-295 2026-08-15 01:14:40 0
pCMV5-Flag-EPLIN beta delta C term
 
Resource Report
Resource Website 		RRID:Addgene_40931 EPLIN beta Homo sapiens Ampicillin PMID:11950948 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin C terminus deleted 2026-08-15 01:14:40 0
PM-FRB-mRFP-T2A-FKBP-5-ptase
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40896 PM-FRB-mRFP-T2A-FKBP-5-ptase Kanamycin PMID:22357943 Vector Backbone:pmRFP-C1; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:14:40 6
pCMV5-Flag-EPLIN beta delta LIM domain
 
Resource Report
Resource Website 		RRID:Addgene_40938 EPLIN beta delta LIM domain Homo sapiens Ampicillin PMID:11950948 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin LIM domain deleted 2026-08-15 01:14:40 0
pCMV5-Flag-EPLIN alpha delta domain 3
 
Resource Report
Resource Website 		RRID:Addgene_40937 EPLIN alpha delta Domain 3 Homo sapiens Ampicillin PMID:11950948 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 106-148 2026-08-15 01:14:40 0
pCMV5-Flag-EPLIN alpha delta N173
 
Resource Report
Resource Website 		RRID:Addgene_40936 EPLIN Homo sapiens Ampicillin PMID:11950948 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-173 2026-08-15 01:14:40 0
pLKO.1puro-shKIBRA-B
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40889 shKIBRA-B Homo sapiens Ampicillin PMID:22614006 Backbone Marker:Addgene 8453; Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:40 1
pBabepuro-KIBRA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40887 KIBRA Homo sapiens Ampicillin PMID:22614006 Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:40 2
pLKO.1puro-shWillin-B
 
Resource Report
Resource Website 		RRID:Addgene_40886 shWillin-B Homo sapiens Ampicillin PMID:21666719 Backbone Marker:Addgene 8453; Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:40 0
pCMV5-Flag-EPLIN beta
 
Resource Report
Resource Website 		RRID:Addgene_40929 EPLIN beta Homo sapiens Ampicillin PMID:11950948 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:40 0
pCMV5-Flag-EPLIN alpha
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40928 EPLIN alpha Homo sapiens Ampicillin PMID:11950948 Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:40 1
pcDNA3-FLAG-ATBF1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40927 ATBF1 Homo sapiens Ampicillin PMID:20720010 Addgene NGS results found S80A, V785A variants compared to the NCBI reference [NM_006885.4]. Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin See depositor comments below. 2026-08-15 01:14:40 1
pKXUa1-HA-ATBF1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40926 ATBF1 Homo sapiens Ampicillin PMID:20720010 Backbone Marker:Kaiming Xu (Emory University); Backbone Size:6750; Vector Backbone:pKXUa1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:40 1
pCS2+8NmOrange
 
Resource Report
Resource Website 		RRID:Addgene_40883 Ampicillin PMID:23124201 Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin 2026-08-15 01:14:40 0
pcDNA3-Smac(1-60)mCherry
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40880 Smac(1-60)mCherry Homo sapiens Ampicillin PMID:20493813 Backbone Size:5523; Vector Backbone:pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:39 4
pBad His6 mOCR TEV LIC cloning vector (8O)
 
Resource Report
Resource Website 		RRID:Addgene_37504 Ampicillin This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8O adds a TEV-cleavable His6-mOCR tag to the N-terminus of your protein. mOCR can enhance the solubility of your protein of interest. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ Backbone Size:6053; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch