Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: GFP-LacI**
Vector Backbone Description: Backbone Marker:Andrew W. Murray Lab, UCSF (Straight, Sedat, & Murray, 1998. PMID: 9813090); Backbone Size:4600; Vector Backbone:pAFS135; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21724830
Comments: The plasmid pAFS135 (Straight, Sedat, and Murray, 1998) contains GFP(S65T, V163A)-LacI(P3Y, del C-terminal 11 aa)-SV40 NLS under the control of a HIS3 promoter fragment. To construct pAT123, the HIS3 marker of AFS135 was replaced with a ScaI-DraIII fragment from RS405 containing LEU2 (a kind gift from Karine Dubrana and Susan Gasser).
The plasmid pAT222 (Addgene plasmid #40942) was obtained by site-directed mutagenesis of pAT123 to create GFP-LacI**, using the primers (base mutations in lowercase):
5’- GTGGCACAgCAACTGGCGGaCAAAggtggcggaTCGTTGCTGATTGGCGTTGCCtCCT-3’ and
5’- AGGaGGCAACGCCAATCAGCAACGAtccgccaccTTTGtCCGCCAGTTGcTGTGCCAC- 3’.
The LacI** variant was then subcloned into pAFS135 using NotI and XhoI restriction sites to create plasmid pAT253.
Proper citation: RRID:Addgene_40943 Copy
Species: Homo sapiens
Genetic Insert: EPLIN alpha delta Domain 7
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40940 Copy
Species: Homo sapiens
Genetic Insert: EPLIN
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40935 Copy
Species: Homo sapiens
Genetic Insert: EPLIN
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40934 Copy
Species: Homo sapiens
Genetic Insert: EPLIN alpha
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40933 Copy
Species: Homo sapiens
Genetic Insert: EPLIN beta
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40931 Copy
Genetic Insert: PM-FRB-mRFP-T2A-FKBP-5-ptase
Vector Backbone Description: Vector Backbone:pmRFP-C1; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22357943
Proper citation: RRID:Addgene_40896 Copy
Species: Homo sapiens
Genetic Insert: EPLIN beta delta LIM domain
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40938 Copy
Species: Homo sapiens
Genetic Insert: EPLIN alpha delta Domain 3
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40937 Copy
Species: Homo sapiens
Genetic Insert: EPLIN
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40936 Copy
Species: Homo sapiens
Genetic Insert: shKIBRA-B
Vector Backbone Description: Backbone Marker:Addgene 8453; Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22614006
Proper citation: RRID:Addgene_40889 Copy
Species: Homo sapiens
Genetic Insert: KIBRA
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22614006
Proper citation: RRID:Addgene_40887 Copy
Species: Homo sapiens
Genetic Insert: shWillin-B
Vector Backbone Description: Backbone Marker:Addgene 8453; Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21666719
Proper citation: RRID:Addgene_40886 Copy
Species: Homo sapiens
Genetic Insert: EPLIN beta
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40929 Copy
Species: Homo sapiens
Genetic Insert: EPLIN alpha
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40928 Copy
Species: Homo sapiens
Genetic Insert: ATBF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20720010
Comments: Addgene NGS results found S80A, V785A variants compared to the NCBI reference [NM_006885.4].
Proper citation: RRID:Addgene_40927 Copy
Species: Homo sapiens
Genetic Insert: ATBF1
Vector Backbone Description: Backbone Marker:Kaiming Xu (Emory University); Backbone Size:6750; Vector Backbone:pKXUa1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20720010
Proper citation: RRID:Addgene_40926 Copy
Vector Backbone Description: Backbone Marker:Turner and Weintraub (1994); Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Sea urchin, zebrafish, Xenopus ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124201
Proper citation: RRID:Addgene_40883 Copy
Species: Homo sapiens
Genetic Insert: Smac(1-60)mCherry
Vector Backbone Description: Backbone Size:5523; Vector Backbone:pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20493813
Proper citation: RRID:Addgene_40880 Copy
Vector Backbone Description: Backbone Size:6053; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8O adds a TEV-cleavable His6-mOCR tag to the N-terminus of your protein. mOCR can enhance the solubility of your protein of interest.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_37504 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
