Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 19 showing 361 ~ 380 out of 566 results
Snippet view Table view Download 566 Result(s)
Click the to add this resource to a Collection
  • RRID:Addgene_24754

http://www.addgene.org/24754

Vector Backbone Description: Backbone Marker:Christopher Buck lab; Backbone Size:1851; Vector Backbone:N/A; Vector Types:Cloning vector; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:20542254
Comments: MCS protected by bacterial transcription terminators.

Proper citation: RRID:Addgene_24754 Copy   


  • RRID:Addgene_17366

http://www.addgene.org/17366

Genetic Insert: GFP
Vector Backbone Description: Backbone Size:3422; Vector Backbone:pEYK3.1; Vector Types:Retroviral; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:12490733
Comments: Note that bacteria with this plasmid grow more slowly than normal.

Proper citation: RRID:Addgene_17366 Copy   


  • RRID:Addgene_173853

http://www.addgene.org/173853

Species: Mus musculus
Genetic Insert: PLD3
Vector Backbone Description: Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:34620855

Proper citation: RRID:Addgene_173853 Copy   


  • RRID:Addgene_50560

http://www.addgene.org/50560

Species: Other
Genetic Insert: Siwi
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19460866

Proper citation: RRID:Addgene_50560 Copy   


  • RRID:Addgene_51290

    This resource has 1+ mentions.

http://www.addgene.org/51290

Species: Homo sapiens
Genetic Insert: L1 ORF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:22918960
Comments: Although a myc tag is present in the full sequence, this tag is not present in this plasmid. pBudORF1-CH was generated by cloning the polymerase chain reaction (PCR)-amplified codon-optimized consensus sequences of each ORF into the HindIII-BamHI sites of the pBudCE4.1 vector in a manner that removes the stop codon of the ORF1, so the expressed protein will contain the his tag at the carboxy terminus. The following primers were used in the amplification of ORF1: 5-AGACCCAAGCTTAGCTAAAACCACAAAGATG-3′ and 5-TGTTCGGATCCGATCTTGGTGTGCTTCTGCAGGGG-3′

Proper citation: RRID:Addgene_51290 Copy   


  • RRID:Addgene_62326

http://www.addgene.org/62326

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV1 isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755 ; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with XmaI

Proper citation: RRID:Addgene_62326 Copy   


  • RRID:Addgene_62357

http://www.addgene.org/62357

Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV2b isolate S24
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI

Proper citation: RRID:Addgene_62357 Copy   


  • RRID:Addgene_48735

    This resource has 1+ mentions.

http://www.addgene.org/48735

Species: NA
Genetic Insert: Tandem dual tomato
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:17603495

Proper citation: RRID:Addgene_48735 Copy   


  • RRID:Addgene_48678

    This resource has 1+ mentions.

http://www.addgene.org/48678

Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24076762

Proper citation: RRID:Addgene_48678 Copy   


  • RRID:Addgene_48679

http://www.addgene.org/48679

Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24076762

Proper citation: RRID:Addgene_48679 Copy   


http://www.addgene.org/29411

Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_29411 Copy   


  • RRID:Addgene_29410

http://www.addgene.org/29410

Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)

Proper citation: RRID:Addgene_29410 Copy   


  • RRID:Addgene_29346

    This resource has 1+ mentions.

http://www.addgene.org/29346

Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:12851414

Proper citation: RRID:Addgene_29346 Copy   


  • RRID:Addgene_29344

    This resource has 1+ mentions.

http://www.addgene.org/29344

Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:12851414

Proper citation: RRID:Addgene_29344 Copy   


  • RRID:Addgene_29343

    This resource has 1+ mentions.

http://www.addgene.org/29343

Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:12851414

Proper citation: RRID:Addgene_29343 Copy   


  • RRID:Addgene_29342

    This resource has 1+ mentions.

http://www.addgene.org/29342

Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:12851414

Proper citation: RRID:Addgene_29342 Copy   


  • RRID:Addgene_29341

    This resource has 1+ mentions.

http://www.addgene.org/29341

Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:12851414

Proper citation: RRID:Addgene_29341 Copy   


  • RRID:Addgene_31289

http://www.addgene.org/31289

Vector Backbone Description: Backbone Size:3905; Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:21238944

Proper citation: RRID:Addgene_31289 Copy   


  • RRID:Addgene_32097

    This resource has 1+ mentions.

http://www.addgene.org/32097

Species: virus
Genetic Insert: MCV Large T antigen
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:3429; Vector Backbone:pMONO-zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:21829355
Comments: Please consult laboratory website, http://home.ccr.cancer.gov/Lco/plasmids.asp, for more information.

Proper citation: RRID:Addgene_32097 Copy   


  • RRID:Addgene_32094

    This resource has 1+ mentions.

http://www.addgene.org/32094

Species: virus
Genetic Insert: BKV VP1
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:21829355
Comments: Please consult laboratory website, http://home.ccr.cancer.gov/Lco/plasmids.asp, for more information.

Proper citation: RRID:Addgene_32094 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X