Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAsylum Resource Report Resource Website |
RRID:Addgene_24754 | Bleocin (Zeocin) | PMID:20542254 | MCS protected by bacterial transcription terminators. | Backbone Marker:Christopher Buck lab; Backbone Size:1851; Vector Backbone:N/A; Vector Types:Cloning vector; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:12:33 | 0 | |||
|
pEYK3.1 Resource Report Resource Website |
RRID:Addgene_17366 | GFP | Bleocin (Zeocin) | PMID:12490733 | Note that bacteria with this plasmid grow more slowly than normal. | Backbone Size:3422; Vector Backbone:pEYK3.1; Vector Types:Retroviral; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:10:33 | 0 | ||
|
SuExp His-Myc-mPLD3 Resource Report Resource Website |
RRID:Addgene_173853 | PLD3 | Mus musculus | Bleocin (Zeocin) | PMID:34620855 | Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | intracellular and transmembrane domain truncated, with only extracellular domain | 2026-08-15 01:10:35 | 0 | |
|
pIZ-Flag6His-Siwi Resource Report Resource Website |
RRID:Addgene_50560 | Siwi | Other | Bleocin (Zeocin) | PMID:19460866 | Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:16:07 | 0 | ||
|
pBudORF1-CH Resource Report Resource Website 1+ mentions |
RRID:Addgene_51290 | L1 ORF1 | Homo sapiens | Bleocin (Zeocin) | PMID:22918960 | Although a myc tag is present in the full sequence, this tag is not present in this plasmid. pBudORF1-CH was generated by cloning the polymerase chain reaction (PCR)-amplified codon-optimized consensus sequences of each ORF into the HindIII-BamHI sites of the pBudCE4.1 vector in a manner that removes the stop codon of the ORF1, so the expressed protein will contain the his tag at the carboxy terminus. The following primers were used in the amplification of ORF1: 5-AGACCCAAGCTTAGCTAAAACCACAAAGATG-3′ and 5-TGTTCGGATCCGATCTTGGTGTGCTTCTGCAGGGG-3′ | Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:16:12 | 1 | |
|
pBoPyV1-S22 Resource Report Resource Website |
RRID:Addgene_62326 | Full genome of BoPyV1 isolate S22 | Viruses (Polyomaviridae) | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with XmaI | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755 ; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:17:52 | 0 | |
|
pBoPyV2b-S24 Resource Report Resource Website |
RRID:Addgene_62357 | Full genome of BoPyV2b isolate S24 | Viruses (Polyomaviridae) | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with EcoRI | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:17:52 | 0 | |
|
ptwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_48735 | Tandem dual tomato | NA | Bleocin (Zeocin) | PMID:17603495 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:15:53 | 1 | ||
|
M-tdTom-ST1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48678 | TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9 | Synthetic | Bleocin (Zeocin) | PMID:24076762 | Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:15:52 | 2 | ||
|
M-tdTom-NM Resource Report Resource Website |
RRID:Addgene_48679 | TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9 | Synthetic | Bleocin (Zeocin) | PMID:24076762 | Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:15:53 | 0 | ||
|
pcDNA3.1/GS-DJ1-A104T Resource Report Resource Website |
RRID:Addgene_29411 | DJ1 | Homo sapiens | Bleocin (Zeocin) | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Ala104Thr | 2026-08-15 01:13:19 | 0 | ||
|
pcDNA3.1/GS-DJ1-C53A Resource Report Resource Website |
RRID:Addgene_29410 | DJ1 | Homo sapiens | Bleocin (Zeocin) | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Cys53Ala | 2026-08-15 01:13:17 | 0 | ||
|
pcDNA3.1/GS-DJ1-E18D-V5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29346 | DJ1 | Homo sapiens | Bleocin (Zeocin) | PMID:12851414 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | E18D | 2026-08-15 01:13:18 | 1 | |
|
pcDNA3.1/GS-DJ1-E64D-V5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29344 | DJ1 | Homo sapiens | Bleocin (Zeocin) | PMID:12851414 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Glu64Asp | 2026-08-15 01:13:16 | 1 | |
|
pcDNA3.1/GS-DJ1-L166P-V5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29343 | DJ1 | Homo sapiens | Bleocin (Zeocin) | PMID:12851414 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | L166P | 2026-08-15 01:13:18 | 1 | |
|
pcDNA3.1/GS-DJ1-E18Q-V5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29342 | DJ1 | Homo sapiens | Bleocin (Zeocin) | PMID:12851414 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | E18Q | 2026-08-15 01:13:18 | 1 | |
|
pcDNA3.1/GS-DJ1-E18N-V5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29341 | DJ1 | Homo sapiens | Bleocin (Zeocin) | PMID:12851414 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Glu18Asn | 2026-08-15 01:13:16 | 1 | |
|
pGMCZq17-OXOX Resource Report Resource Website |
RRID:Addgene_31289 | Bleocin (Zeocin) | PMID:21238944 | Backbone Size:3905; Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:13:34 | 0 | ||||
|
pADL* Resource Report Resource Website 1+ mentions |
RRID:Addgene_32097 | MCV Large T antigen | virus | Bleocin (Zeocin) | PMID:21829355 | Please consult laboratory website, http://home.ccr.cancer.gov/Lco/plasmids.asp, for more information. | Backbone Marker:InvivoGen; Backbone Size:3429; Vector Backbone:pMONO-zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 57kT splice sites silently mutated, P156S to match consensus | 2026-08-15 01:13:38 | 2 |
|
pwB2b Resource Report Resource Website 1+ mentions |
RRID:Addgene_32094 | BKV VP1 | virus | Bleocin (Zeocin) | PMID:21829355 | Please consult laboratory website, http://home.ccr.cancer.gov/Lco/plasmids.asp, for more information. | Backbone Size:5338; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | codon modified | 2026-08-15 01:13:38 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
