Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: avr-14 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GATTGGAGAGTTAGACCACG
Proper citation: RRID:Addgene_58981 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:4872; Vector Backbone:pUG35; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26184437
Proper citation: RRID:Addgene_58980 Copy
Species: Drosophila melanogaster
Genetic Insert: Patronin
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pENTR; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919
Proper citation: RRID:Addgene_59048 Copy
Species: Synthetic
Genetic Insert: mito-ZapCY1 high affinity Zn(II) sensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22850482
Comments: Genetically encoded, ratiometric, fluorescent biosensor. mito-ZapCY1 contains 4 tandem repeats of the first 29 aa of human cox subunit 8a (MSVLTPLLLRGLTGSARRLPVPRAKIHSL). HindIII restriction sites are at the 5' and 3' ends of the mitochondrial targeting sequence. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains truncated CFP and Citrine fluorescent proteins.
Proper citation: RRID:Addgene_58996 Copy
Species: Homo sapiens
Genetic Insert: CAMSAP2 CC domain
Vector Backbone Description: Vector Backbone:pFasBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24706919
Proper citation: RRID:Addgene_59040 Copy
Species: Homo sapiens
Genetic Insert: Rb
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24876129
Comments: *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826
Proper citation: RRID:Addgene_58914 Copy
Species: Homo sapiens
Genetic Insert: Rb
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24876129
Comments: *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826
Proper citation: RRID:Addgene_58918 Copy
Species: Homo sapiens
Genetic Insert: Rb
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24876129
Comments: *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826
Proper citation: RRID:Addgene_58920 Copy
Species: Drosophila melanogaster
Genetic Insert: Patronin
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24706919
Proper citation: RRID:Addgene_59053 Copy
Species: Stigeoclonium helveticum
Genetic Insert: Chronos-GFP
Vector Backbone Description: Backbone Marker:Addgene (Plasmid 11159); Backbone Size:5117; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24509633
Comments: The depositing lab sequenced this plasmid completely except for the CAG promoter.
Proper citation: RRID:Addgene_59056 Copy
Species: Drosophila melanogaster
Genetic Insert: Patronin
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24706919
Proper citation: RRID:Addgene_59055 Copy
Species: Mus musculus
Genetic Insert: mitogen-activated protein kinase 8 interacting protein 3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcdna3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10629060
Proper citation: RRID:Addgene_58924 Copy
Species: Mus musculus
Genetic Insert: Mapk8ip4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcdna3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15767678
Proper citation: RRID:Addgene_58928 Copy
Species: Danio rerio
Genetic Insert: mcherry-2a-Rac2D57N
Vector Backbone Description: Backbone Size:3500; Vector Backbone:Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22014524
Proper citation: RRID:Addgene_58934 Copy
Species: Chloromonas oogama
Genetic Insert: CoChR-GFP
Vector Backbone Description: Backbone Size:4368; Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24509633
Comments: Plasmid is completely sequenced by the depositing lab except for part of the 3' ITR. Addgene QC NGS analysis identifies ambiguous bases following the 3' ITR. It is unknown what, if any, impact this may have on plasmid function.
Proper citation: RRID:Addgene_59070 Copy
Genetic Insert: mpeg1-mcherry
Vector Backbone Description: Backbone Size:3500; Vector Backbone:Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_58935 Copy
Species: Gallus gallus
Genetic Insert: Focal Adhesion Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23393139
Comments: Discrepancies between QC and full sequence are of no functional consequence
Proper citation: RRID:Addgene_59119 Copy
Species: Danio rerio
Genetic Insert: Kit receptor a mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20525357
Proper citation: RRID:Addgene_58948 Copy
Species: Gallus gallus
Genetic Insert: Focal Adhesion Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23393139
Comments: Discrepancies between QC and full sequence are of no functional consequence
Proper citation: RRID:Addgene_59126 Copy
Species: Gallus gallus
Genetic Insert: Focal Adhesion Kinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23393139
Comments: Discrepancies between QC and full sequence are of no functional consequence
Proper citation: RRID:Addgene_59125 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
