Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCCM936
 
Resource Report
Resource Website 		RRID:Addgene_58981 avr-14 sgRNA Caenorhabditis elegans Kanamycin PMID:24879462 gRNA target sequence GATTGGAGAGTTAGACCACG Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
pMitoLOC
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58980 mCherry Synthetic Ampicillin PMID:26184437 Backbone Size:4872; Vector Backbone:pUG35; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 5
pENTR-GFP-Patronin CC+CKK
 
Resource Report
Resource Website 		RRID:Addgene_59048 Patronin Drosophila melanogaster Kanamycin PMID:24706919 Backbone Marker:Invitrogen; Vector Backbone:pENTR; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
pcDNA-mito-ZapCY1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58996 mito-ZapCY1 high affinity Zn(II) sensor Synthetic Ampicillin PMID:22850482 Genetically encoded, ratiometric, fluorescent biosensor. mito-ZapCY1 contains 4 tandem repeats of the first 29 aa of human cox subunit 8a (MSVLTPLLLRGLTGSARRLPVPRAKIHSL). HindIII restriction sites are at the 5' and 3' ends of the mitochondrial targeting sequence. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains truncated CFP and Citrine fluorescent proteins. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 2
pFasBac+GFP-CAMSAP2 CC
 
Resource Report
Resource Website 		RRID:Addgene_59040 CAMSAP2 CC domain Homo sapiens Ampicillin PMID:24706919 Vector Backbone:pFasBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 0
pCMV HA hRB delta CDK + S612
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58914 Rb Homo sapiens Ampicillin PMID:24876129 *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826 Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin delta CDK* with S612 restored 2026-08-15 01:17:19 1
pCMV HA hRB delta CDK + S807
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58918 Rb Homo sapiens Ampicillin PMID:24876129 *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826 Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin delta CDK* with S807 restored 2026-08-15 01:17:19 1
pCMV HA hRB delta CDK + T821
 
Resource Report
Resource Website 		RRID:Addgene_58920 Rb Homo sapiens Ampicillin PMID:24876129 *CDK mutations (all changed to Ala): T5, S239, S249, T252, T356, T373, S608, S612, S780, S788, S795, S807, S811, T821, T826 Backbone Marker:Clontech; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin delta CDK* with T821 restored 2026-08-15 01:17:19 0
pET-28a-GFP-Patronin CC 868–1457
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59053 Patronin Drosophila melanogaster Kanamycin PMID:24706919 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 1
pCAG-FLEX-rc[Chronos-GFP]
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59056 Chronos-GFP Stigeoclonium helveticum Ampicillin PMID:24509633 The depositing lab sequenced this plasmid completely except for the CAG promoter. Backbone Marker:Addgene (Plasmid 11159); Backbone Size:5117; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 3
pET-21a-GFP-Patronin CC 1288–1457
 
Resource Report
Resource Website 		RRID:Addgene_59055 Patronin Drosophila melanogaster Ampicillin PMID:24706919 Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 0
pcdna3 Flag Jip3b(T266A, T276A, T287A)
 
Resource Report
Resource Website 		RRID:Addgene_58924 mitogen-activated protein kinase 8 interacting protein 3 Mus musculus Ampicillin PMID:10629060 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcdna3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed T266A, T276A, T287A 2026-08-15 01:17:19 0
pCDNA3 T7 Jip4 (1-272)
 
Resource Report
Resource Website 		RRID:Addgene_58928 Mapk8ip4 Mus musculus Ampicillin PMID:15767678 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcdna3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Jip4 (1-272aa) 2026-08-15 01:17:19 0
Tg (mpx:mCherry-2A-Rac2D57N)
 
Resource Report
Resource Website 		RRID:Addgene_58934 mcherry-2a-Rac2D57N Danio rerio Ampicillin PMID:22014524 Backbone Size:3500; Vector Backbone:Tol2; Vector Types:; Bacterial Resistance:Ampicillin changed Aspartate 57 to Asparagine 2026-08-15 01:17:19 0
pAAV-Syn-CoChR-GFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_59070 CoChR-GFP Chloromonas oogama Ampicillin PMID:24509633 Plasmid is completely sequenced by the depositing lab except for part of the 3' ITR. Addgene QC NGS analysis identifies ambiguous bases following the 3' ITR. It is unknown what, if any, impact this may have on plasmid function. Backbone Size:4368; Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 11
tol2-mpeg1-mcherry
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58935 mpeg1-mcherry Ampicillin Backbone Size:3500; Vector Backbone:Tol2; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 2
pCDNA-FRT-FAK10
 
Resource Report
Resource Website 		RRID:Addgene_59119 Focal Adhesion Kinase Gallus gallus Ampicillin PMID:23393139 Discrepancies between QC and full sequence are of no functional consequence Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 0
SI16-Kit a
 
Resource Report
Resource Website 		RRID:Addgene_58948 Kit receptor a mouse monoclonal antibody Danio rerio Ampicillin PMID:20525357 Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 0
pCDNA-FRT-FAK-FERM10
 
Resource Report
Resource Website 		RRID:Addgene_59126 Focal Adhesion Kinase Gallus gallus Ampicillin PMID:23393139 Discrepancies between QC and full sequence are of no functional consequence Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:21 0
pCDNA-FRT-FAK-FERM0
 
Resource Report
Resource Website 		RRID:Addgene_59125 Focal Adhesion Kinase Gallus gallus Ampicillin PMID:23393139 Discrepancies between QC and full sequence are of no functional consequence Backbone Marker:Invitrogen; Backbone Size:5002; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch