Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,854 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pcDNA-NES-ZapCY2
 
Resource Report
Resource Website 		RRID:Addgene_59016 NES-ZapCY2 genetically encoded cytosolic Zn(II) sensor Synthetic Ampicillin PMID:23992616 Genetically encoded, ratiometric, fluorescent biosensor. Contains nuclear exclusion signal sequence at N-terminus. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains truncated CFP and Citrine fluorescent proteins. The Zn(II) binding domain of ZapCY2 is derived from ZapCY1. The first cysteine in each zinc finger is mutated to histidine. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin See comment 2026-08-15 01:17:20 0
pcDNA-NES-ZapCmR2
 
Resource Report
Resource Website 		RRID:Addgene_59015 NES-ZapCmR2 genetically encoded cytosolic Zn(II) sensor Synthetic Ampicillin PMID:23173058 Genetically encoded, ratiometric, fluorescent biosensor. Contains nuclear exclusion signal sequence at N-terminus. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains Clover and mRuby fluorescent proteins. The Zn(II) binding domain of ZapCmR2 is derived from ZapCmR1.1. The first cysteine in the second zinc finger is mutated to histidine. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin See comment 2026-08-15 01:17:20 0
pcDNA-mito-ZifCV1.173
 
Resource Report
Resource Website 		RRID:Addgene_59010 mito-ZifCV1.173 genetically encoded Zn(II) sensor Synthetic Ampicillin PMID:22850482 Genetically encoded, ratiometric, fluorescent biosensor targeted to the mitochondria. mito-ZifCV1.173 contains 4 tandem repeats of the first 29 aa of human cox subunit 8a (MSVLTPLLLRGLTGSARRLPVPRAKIHSL). HindIII restriction sites are at the 5' and 3' ends of the mitochondrial targeting sequence. Zn(II)-binding domain derived from mammalian Zif268. Contains truncated CFP and circularly permuted Venus 173. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 0
pCS2-FAK30
 
Resource Report
Resource Website 		RRID:Addgene_59131 Focal Adhesion Kinase Gallus gallus Ampicillin PMID:23393139 Discrepancies between QC and full sequence are of no functional consequence Backbone Marker:Invitrogen; Backbone Size:3777; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:21 0
pCS2-FAK20
 
Resource Report
Resource Website 		RRID:Addgene_59130 Focal Adhesion Kinase Gallus gallus Ampicillin PMID:23393139 Backbone Marker:Invitrogen; Backbone Size:3777; Vector Backbone:pcDNA-5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 0
pOTTC589 - pAAV c-fos Nuc-eYFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59133 Nuclear-localized Enhanced Yellow Fluorescent Protein Ampicillin PMID:28380331 Backbone Marker:OTTC/NIDA; Vector Backbone:pOTTC476; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:17:21 1
pcDNA-NLS-ZapCmR1.1
 
Resource Report
Resource Website 		RRID:Addgene_59011 NLS-ZapCmR1.1 genetically encoded Zn(II) sensor Synthetic Ampicillin PMID:23173058 Genetically encoded, ratiometric, fluorescent biosensor. Contains NLS sequence at N-terminus. Zn(II)-binding domain derived from the first 2 zinc fingers of Zap 1 from Saccharomyces cerevisiae. Contains Clover and mRuby fluorescent proteins. The Zn(II) binding domain of ZapCmR1.1 is derived from ZapCY1. The first cysteine in the first zinc finger is mutated to histidine. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin See comment 2026-08-15 01:17:20 0
pOTTC588 - pAAV c-fos Nuc-iRFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59132 Nuclear-localized Infrared Fluorescent Protein Ampicillin PMID:28380331 Backbone Marker:OTTC/NIDA; Vector Backbone:pOTTC475; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 1
T7-VEE-OKS-iM
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58972 Oct4 Homo sapiens Ampicillin PMID:23910086 Summary of features: 1-7561: VEE RNA replicases (nsP1, nsP2, nsP3, nsP4 and 26S promoter, nsP1~4 are nonstructural VEE sequences which encode RNA replicases) 7592-8671: human Oct4 8678-8731: T2A peptide sequence 8738-10147: human Klf4 10154-10213: E2A peptide sequence 10223-11176: human Sox2 11195-11805: IRES sequence 11818-13140: human cMyc 13165-13776: IRES sequence 13777-14376: Puromycin resistance gene 14383-14510:VEE 3’UTR and poly A tail 14679-15539: Ampicillin resistance gene 16319-16336: T7 promoter Backbone Marker:Dowdy lab; Vector Backbone:T7-VEE-IRES-puro (Addgene plasmid 58970); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 2
SP6-VEE-IRES-Puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58971 Ampicillin PMID:23910086 Backbone Marker:gift from I. Frolov; Backbone Size:10793; Vector Backbone:VEE backbone; Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 1
AAVS1-TALEN-R
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_59026 AAVS1-TALEN-R Synthetic Ampicillin PMID:24931489 Backbone Marker:Feng Zhang Lab; Backbone Size:7961; Vector Backbone:pTALEN; Vector Types:Mammalian Expression, AAV, TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 57
SP6-VEE-OKS-iM
 
Resource Report
Resource Website 		RRID:Addgene_58973 Oct4 Homo sapiens Ampicillin PMID:23910086 Summary of features: 1-7561: VEE RNA replicases (nsP1, nsP2, nsP3, nsP4 and 26S promoter, nsP1~4 are nonstructural VEE sequences which encode RNA replicases) 7592-8671: human Oct4 8678-8731: T2A peptide sequence 8738-10147: human Klf4 10154-10213: E2A peptide sequence 10223-11176: human Sox2 11195-11805: IRES sequence 11818-13140: human cMyc 13165-13776: IRES sequence 13777-14376: Puromycin resistance gene 14383-14510:VEE 3’UTR and poly A tail 14679-15539: Ampicillin resistance gene 16320-16337: SP6 promoter Backbone Marker:Dowdy lab; Vector Backbone:SP6-VEE-IRES-puro (Addgene plasmid 58971); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 0
SP6-VEE-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58976 EGFP Aequorea victoria Ampicillin PMID:23910086 For author-annotated map, please see T7-VEE-GFP (Addgene plasmid 58977). Backbone Marker:Dowdy lab; Vector Backbone:Sp6-VEE-IRES-puro (Addgene plasmid 58971); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 1
SP6-VEE-OKS-iG
 
Resource Report
Resource Website 		RRID:Addgene_58975 Oct4 Homo sapiens Ampicillin PMID:23910086 Summary of features: 1-7561: VEE RNA replicases (nsP1, nsP2, nsP3, nsP4 and 26S promoter) 7592-8671: human Oct4 8678-8731: T2A peptide sequence 8738-10147: human Klf4 10154-10213: E2A peptide sequence 10223-11176: human Sox2 11195-11805: IRES sequence 11818-13680: human Glis1 13689-14300: IRES sequence 14301-14900: Puromycin resistance gene 14907-15034: VEE 3’UTR and poly A tail 15203-16063: Ampicillin resistance gene 16844-16861: SP6 promoter Backbone Marker:Dowdy lab; Vector Backbone:SP6-VEE-IRES-puro (Addgene plasmid 58971); Vector Types:Mammalian Expression, Venezuelan equine encephalitis (VEE) virus RNA replicon; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 0
pCCM937
 
Resource Report
Resource Website 		RRID:Addgene_58982 avr-15 sgRNA Caenorhabditis elegans Kanamycin PMID:24879462 gRNA target sequence GTTTGCAATATAAGTCACCC Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
pFasBac+GFP-CAMSAP2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59037 CAMSAP2 Homo sapiens Ampicillin PMID:24706919 Vector Backbone:pFasBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 2
pFasBac+GFP-CAMSAP2 CC+CKK
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_59039 CAMSAP2 CC+CKK domains Homo sapiens Ampicillin PMID:24706919 Vector Backbone:pFasBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 1
pMIG-IRF4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_58987 Mouse IRF4 Mus musculus Ampicillin PMID:25006123 Vector Backbone:MIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:20 3
pET-28a+GFP-CAMSAP2 CKK
 
Resource Report
Resource Website 		RRID:Addgene_59032 CAMSAP2 CKK domain Homo sapiens Kanamycin PMID:24706919 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0
pET-28a+GFP-CAMSAP1 CKK
 
Resource Report
Resource Website 		RRID:Addgene_59031 CAMSAP1 CKK domain Homo sapiens Kanamycin PMID:24706919 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:20 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch