Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,854 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
AMPK-β2-MYC
 
Resource Report
Resource Website 		RRID:Addgene_40606 AMPK-β2 Mus musculus Kanamycin PMID:17012231 Does not express well. Minimal kozak only GCCATGGG. Backbone Size:4300; Vector Backbone:pCMV-Tag5a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:37 0
pEMB12 LRRK2_BC_1847_2210_K1906M
 
Resource Report
Resource Website 		RRID:Addgene_40564 LRRK2 Homo sapiens Ampicillin Backbone Marker:Emerald; Vector Backbone:pEMB12; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin aa1847_2210; K1906M 2026-08-15 01:14:37 0
pEMB36(revcomp)/Dvl1_1_670
 
Resource Report
Resource Website 		RRID:Addgene_40557 DVL1 Homo sapiens Ampicillin The insert has been codon optimized. Backbone Marker:Emerald; Vector Backbone:pEMB36; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin WT; aa1_670 2026-08-15 01:14:37 0
pEMB44 / Mouse_LRRK2_1_342
 
Resource Report
Resource Website 		RRID:Addgene_40555 Lrrk2 Mus musculus Ampicillin Backbone Marker:Emerald; Vector Backbone:pEMB44; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin WT 2026-08-15 01:14:37 0
pEMB12 / LRRK2_BC_1847_2210
 
Resource Report
Resource Website 		RRID:Addgene_40553 LRRK2 Homo sapiens Ampicillin Backbone Marker:Emerald; Vector Backbone:pEMB12; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin WT; aa1847_2210 2026-08-15 01:14:37 0
pEMB52/Horse_34_374
 
Resource Report
Resource Website 		RRID:Addgene_40544 LRRK2 Equus caballus Ampicillin Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin WT 2026-08-15 01:14:37 0
pEMB52/Armadillo_34_373
 
Resource Report
Resource Website 		RRID:Addgene_40543 LRRK2 Dasypus novemcinctus Ampicillin Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin WT 2026-08-15 01:14:37 0
pEMB52/Dvl1_1_670
 
Resource Report
Resource Website 		RRID:Addgene_40542 DVL1 Homo sapiens Ampicillin Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin WT 2026-08-15 01:14:37 0
pEMB52/14-3-3_1_247
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40541 YWHAG Homo sapiens Ampicillin Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin WT; aa1-247 2026-08-15 01:14:37 1
phage-cmv-cfp-24xpp7
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40652 CFP-24xPP7 Synthetic Ampicillin PMID:22735544 Please note that the final PP7 stem loop ends with CCAGCAGAGCATATGGGCTCG The depositing laboratory confirmed that the plasmid functions as described in the associated publication. The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is: taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt Vector Backbone:pHAGE-CMV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:38 5
phage-cmv-cfp-24xms2
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_40651 CFP-24xMBS Synthetic Ampicillin PMID:22735544 The Singer Lab no longer recommends this plasmid, as it has a higher rate of bacterial recombination. For mammalian cells they recommend the following plasmids: pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Plasmid #84561) HaloTag-bActinCDS-bActinUTR-MS2V5 (Plasmid #102718) For yeast cells they recommend the following plasmids: pET246-pUC57 12xMS2V6 (Plasmid #104390) pET259-pUC57 24xMS2V6 (Plasmid #104391) pET251-pUC 12xMS2V6 Loxp KANr Loxp (Plasmid #104392) pET264-pUC 24xMS2V6 Loxp KANr Loxp (Plasmid #104393) Due to the propensity of the plasmid to recombine, Addgene recommends screening multiple colonies by restriction analysis to ensure that the isolated clones contain a full set of 24 MS2 repeats Vector Backbone:pHAGE-CMV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:38 11
phage-ubc-nls-ha-tdPCP-gfp
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40650 tdPCP-gfp Synthetic Ampicillin PMID:22735544 The linker region between the two PCPs is CGTGCGGATCCGCTAGCCTCC Vector Backbone:pHAGE-UBC-RIG (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:38 9
phage-ubc-nls-ha-tdMCP-gfp
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_40649 tdMCP-gfp Synthetic Ampicillin PMID:22735544 The linker region between the two MCPs is ATCTACGCCATGGCTTCT Vector Backbone:pHAGE-UBC-RIG (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:38 21
pLKO.1-sh-hSOX9-1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_40644 sh-hSOX9-1 Homo sapiens Ampicillin PMID:22385965 Backbone Marker:Weinberg lab; Backbone Size:7032; Vector Backbone:pLKO.1 puro (Addgene plasmid 8453); Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:14:38 11
mutpRL-TK 4xUTR
 
Resource Report
Resource Website 		RRID:Addgene_40759 4 copies of the CXCR4 small RNA target site Ampicillin PMID:21878547 Backbone Marker:Sharp Lab (http://web.mit.edu/sharplab/RNAi/Cloning.html); Vector Backbone:mutpRL-TK; Vector Types:Luciferase; Bacterial Resistance:Ampicillin mutated from TAG to CTC at nt 387–389 of the Renilla luciferase open reading frame to generate mismatches with seed positions 5, 6, and 7 of the siRNA guide strand by PCR-directed mutagenesis 2026-08-15 01:14:38 0
mutpRL-TK 3xUTR
 
Resource Report
Resource Website 		RRID:Addgene_40758 3 copies of the CXCR4 small RNA target site Ampicillin PMID:21878547 Backbone Marker:Sharp Lab (http://web.mit.edu/sharplab/RNAi/Cloning.html); Vector Backbone:mutpRL-TK; Vector Types:Luciferase; Bacterial Resistance:Ampicillin mutated from TAG to CTC at nt 387–389 of the Renilla luciferase open reading frame to generate mismatches with seed positions 5, 6, and 7 of the siRNA guide strand by PCR-directed mutagenesis 2026-08-15 01:14:38 0
p3.5VPIII.EGFP.IGR2.1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_40865 Mouse vasopressin gene Mus musculus Ampicillin PMID:12944509 the following mutations are known and do not effect plasmid function: TT--5510CTTG, G5386A, A4984T,A6794G. Backbone Size:4000; Vector Backbone:pSE280; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:39 1
pNH9
 
Resource Report
Resource Website 		RRID:Addgene_40860 repeat NH9 Xanthomonas oryzae Tetracycline PMID:21493687 Backbone Size:3013; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline 2026-08-15 01:14:39 0
pNH7
 
Resource Report
Resource Website 		RRID:Addgene_40858 repeat NH7 Xanthomonas oryzae Tetracycline PMID:21493687 Backbone Size:3013; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline 2026-08-15 01:14:39 0
pNH5
 
Resource Report
Resource Website 		RRID:Addgene_40856 repeat NH5 Xanthomonas oryzae Tetracycline PMID:21493687 Backbone Size:3013; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline 2026-08-15 01:14:39 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch