Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: AMPK-β2
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag5a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Comments: Does not express well. Minimal kozak only GCCATGGG.
Proper citation: RRID:Addgene_40606 Copy
Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Emerald; Vector Backbone:pEMB12; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40564 Copy
Species: Homo sapiens
Genetic Insert: DVL1
Vector Backbone Description: Backbone Marker:Emerald; Vector Backbone:pEMB36; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Comments: The insert has been codon optimized.
Proper citation: RRID:Addgene_40557 Copy
Species: Mus musculus
Genetic Insert: Lrrk2
Vector Backbone Description: Backbone Marker:Emerald; Vector Backbone:pEMB44; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40555 Copy
Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Emerald; Vector Backbone:pEMB12; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40553 Copy
Species: Equus caballus
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40544 Copy
Species: Dasypus novemcinctus
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40543 Copy
Species: Homo sapiens
Genetic Insert: DVL1
Vector Backbone Description: Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40542 Copy
Species: Homo sapiens
Genetic Insert: YWHAG
Vector Backbone Description: Backbone Marker:Emerald; Vector Backbone:pEMB52; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40541 Copy
Species: Synthetic
Genetic Insert: CFP-24xPP7
Vector Backbone Description: Vector Backbone:pHAGE-CMV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: Please note that the final PP7 stem loop ends with CCAGCAGAGCATATGGGCTCG The depositing laboratory confirmed that the plasmid functions as described in the associated publication.
The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is:
taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt
Proper citation: RRID:Addgene_40652 Copy
Species: Synthetic
Genetic Insert: CFP-24xMBS
Vector Backbone Description: Vector Backbone:pHAGE-CMV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: The Singer Lab no longer recommends this plasmid, as it has a higher rate of bacterial recombination.
For mammalian cells they recommend the following plasmids:
pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Plasmid #84561)
HaloTag-bActinCDS-bActinUTR-MS2V5 (Plasmid #102718)
For yeast cells they recommend the following plasmids:
pET246-pUC57 12xMS2V6 (Plasmid #104390)
pET259-pUC57 24xMS2V6 (Plasmid #104391)
pET251-pUC 12xMS2V6 Loxp KANr Loxp (Plasmid #104392)
pET264-pUC 24xMS2V6 Loxp KANr Loxp (Plasmid #104393)
Due to the propensity of the plasmid to recombine, Addgene recommends screening multiple colonies by restriction analysis to ensure that the isolated clones contain a full set of 24 MS2 repeats
Proper citation: RRID:Addgene_40651 Copy
Species: Synthetic
Genetic Insert: tdPCP-gfp
Vector Backbone Description: Vector Backbone:pHAGE-UBC-RIG (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: The linker region between the two PCPs is CGTGCGGATCCGCTAGCCTCC
Proper citation: RRID:Addgene_40650 Copy
Species: Synthetic
Genetic Insert: tdMCP-gfp
Vector Backbone Description: Vector Backbone:pHAGE-UBC-RIG (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: The linker region between the two MCPs is ATCTACGCCATGGCTTCT
Proper citation: RRID:Addgene_40649 Copy
Species: Homo sapiens
Genetic Insert: sh-hSOX9-1
Vector Backbone Description: Backbone Marker:Weinberg lab; Backbone Size:7032; Vector Backbone:pLKO.1 puro (Addgene plasmid 8453); Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22385965
Proper citation: RRID:Addgene_40644 Copy
Genetic Insert: 4 copies of the CXCR4 small RNA target site
Vector Backbone Description: Backbone Marker:Sharp Lab (http://web.mit.edu/sharplab/RNAi/Cloning.html); Vector Backbone:mutpRL-TK; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21878547
Proper citation: RRID:Addgene_40759 Copy
Genetic Insert: 3 copies of the CXCR4 small RNA target site
Vector Backbone Description: Backbone Marker:Sharp Lab (http://web.mit.edu/sharplab/RNAi/Cloning.html); Vector Backbone:mutpRL-TK; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21878547
Proper citation: RRID:Addgene_40758 Copy
Species: Mus musculus
Genetic Insert: Mouse vasopressin gene
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSE280; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12944509
Comments: the following mutations are known and do not effect plasmid function: TT--5510CTTG, G5386A, A4984T,A6794G.
Proper citation: RRID:Addgene_40865 Copy
Species: Xanthomonas oryzae
Genetic Insert: repeat NH9
Vector Backbone Description: Backbone Size:3013; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_40860 Copy
Species: Xanthomonas oryzae
Genetic Insert: repeat NH7
Vector Backbone Description: Backbone Size:3013; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_40858 Copy
Species: Xanthomonas oryzae
Genetic Insert: repeat NH5
Vector Backbone Description: Backbone Size:3013; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_40856 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
