Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCGN-BCL-6Δ (pCGN-BCL6-delta) Resource Report Resource Website |
RRID:Addgene_40338 | BCL-6Δ | Homo sapiens | Ampicillin | PMID:10973278 | The expression plasmid pCGN-BCL-6Δ was constructed by digesting the BCL-6 cDNA with EcoRI, deleting the 3' region, and cloning the remaining cDNA into pCGN. The BCL-6Δ is missing four of six zinc fingers and does not bind to a consensus BCL-6 probe in a gel shift assay (A. L. Dent, unpublished data). Note, the cloning and ligation adds the following residues after aa595 of BCL6: RYQAYRYRRPGYR | Backbone Marker:Masafumi Tanaka and Winship Herr (PMID: 2302733); Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Missing four of six zinc fingers (see note below); contains aa 1-595 | 2026-08-15 01:14:35 | 0 |
|
pFRT/FLAG/HA-DEST PUM2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40292 | Pumilio homolog 2 | Homo sapiens | Ampicillin | PMID:20371350 | Note that there are some cloning scars flanking the insert (see Addgene sequence), but they will not affect plasmid function. | Backbone Size:5372; Vector Backbone:pFRT/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 1 | |
|
pCalN-ddGFP-A Resource Report Resource Website 1+ mentions |
RRID:Addgene_40290 | Calnexin | Homo sapiens | Ampicillin | PMID:23656278 | Addgene sequencing results find I474N in calnexin translation compared to reference sequence NP_001737.1 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 1 | |
|
pMCP-MU-Luc (MCP-1 mut promoter in pGL3-basic) Resource Report Resource Website |
RRID:Addgene_40325 | MCP-1 promoter (mutated) | Mus musculus | Ampicillin | PMID:10973278 | Note: Addgene NGS results identified an extra ~500 bp region upstream of the expected promoter, which contains a CMV enhancer feature. It is unknown what impact the region may have on plasmid function, but the extra sequence appears to have been present in the original sample received by Addgene. A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers: 5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start) 5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start) The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers: 5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′ 5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′ and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic. For the construction of the MCP-1 mutant promoter, the BCL-6 site was mutated by a two step PCR–based strategy using the above flanking primers and the following complementary primers to mutate the BCL-6 site: 5′–TCTCTCTTCCACTTCCT[TT]AAACA–3′ 5′–TGTTT[AA]AGGAAGTGGAAGAGAGA–3′ (mutated bases are in brackets) The mutant promoter was cloned into pGL3 via XhoI and XmaI. The wild-type and mutant MCP-1 promoter sequences were verified by sequencing. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | contains MCP-1 promoter region through the nucleotides 28-bp downstream of the MCP-1 TATA site. Sequence has two base changes from the wild-type MCP-1 promoter around the -150 bp position (see note below). | 2026-08-15 01:14:35 | 0 |
|
2C::tdTomato Reporter Resource Report Resource Website 10+ mentions |
RRID:Addgene_40281 | 2C Promoter (2-cell stage promoter) | Mus musculus | Ampicillin | PMID:22722858 | The CMV promoter from the parent pcDNA plasmid was removed with MluI and HindIII, leaving approx. 6400kb backbone. The 2C promoter was put in its place (730bp) using the same sites. Hence, the full plasmid is 7129bp. The promoter is active shortly after fertilization of mouse embryos to about the 8-cell stage. It is also on in a subset of MESCs & miPSCs. | Backbone Marker:Invitrogen/Life Tech; Backbone Size:6400; Vector Backbone:pcDNA Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 15 | |
|
pDDYFP-B Resource Report Resource Website |
RRID:Addgene_40289 | ddYFP-B | Synthetic | Ampicillin | PMID:23656278 | Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pBad-modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 0 | ||
|
JDS94 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40322 | Ampicillin | Backbone contains NNN/G 0.5 Domain TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: ELD (-) heterodimer (Doyon et al. 2011) | Backbone Size:6447; Vector Backbone:JDS94; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 1 | ||||
|
JDS92 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40321 | Ampicillin | Backbone contains SHD/C 0.5 Domain TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: ELD (-) heterodimer (Doyon et al. 2011) | Backbone Size:6447; Vector Backbone:JDS92; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 1 | ||||
|
pDDGFP-B Resource Report Resource Website 1+ mentions |
RRID:Addgene_40287 | ddGFP-B | Synthetic | Ampicillin | PMID:23656278 | Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pBad-modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 2 | ||
|
JDS90 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40320 | Ampicillin | Backbone contains SNI/A 0.5 Domain TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: ELD (-) heterodimer (Doyon et al. 2011) | Backbone Size:6447; Vector Backbone:JDS90; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 1 | ||||
|
pUAST-NaChBac Resource Report Resource Website 1+ mentions |
RRID:Addgene_40283 | NaChBac | Ampicillin | PMID:16407556 | Backbone Size:8914; Vector Backbone:pUAST; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 1 | |||
|
pUAST-NachBac-EGFP Resource Report Resource Website |
RRID:Addgene_40282 | NaChBac-EGFP | Bacillus halodurans | Ampicillin | PMID:16407556 | Backbone Size:8914; Vector Backbone:pUAST; Vector Types:Drosophila; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 0 | ||
|
JDS88 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40319 | Ampicillin | Backbone contains SNG/T 0.5 Domain TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: KKR (+) heterodimer (Doyon et al. 2011) | Backbone Size:6447; Vector Backbone:JDS88; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 1 | ||||
|
JDS80 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40316 | Ampicillin | Backbone contains SNI/A 0.5 Domain TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: KKR (+) heterodimer (Doyon et al. 2011) | Backbone Size:6447; Vector Backbone:JDS80; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 1 | ||||
|
pHLUM Resource Report Resource Website 1+ mentions |
RRID:Addgene_40276 | LEU2 | Saccharomyces cerevisiae | Ampicillin | PMID:23222782 | Backbone Marker:ATCC, Number: 77142; Backbone Size:4967; Vector Backbone:pRS313; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 9 | ||
|
perbB1Y1045F-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_40267 | erbB1 | Homo sapiens | Kanamycin | PMID:17956594 | Backbone Marker:Clontech; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Tyr1045>Phe | 2026-08-15 01:14:35 | 2 | |
|
perbB1-Citrine Resource Report Resource Website 1+ mentions |
RRID:Addgene_40266 | erbB1 | Homo sapiens | Kanamycin | PMID:17956594 | Backbone Marker:Clontech; Vector Backbone:pEYFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:35 | 1 | ||
|
pHM6-Q23 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40263 | HTT partial exon 1 Q23 | Homo sapiens | Ampicillin | PMID:10528852 | Backbone Marker:Roche; Backbone Size:5450; Vector Backbone:pHM6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | expanded poly-Q | 2026-08-15 01:14:35 | 7 | |
|
pBACgus/LRRK2 1867-2161 C-His_C2024S/C2025S Resource Report Resource Website |
RRID:Addgene_40384 | LRRK2 | Homo sapiens | Ampicillin | Backbone Marker:Novagen; Vector Backbone:pBACgus; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | aa1867-2161, C2024S/C2025S | 2026-08-15 01:14:36 | 0 | ||
|
pBACgus/LRRK2 C-His_C2024S/C2025S Resource Report Resource Website |
RRID:Addgene_40383 | LRRK2 | Homo sapiens | Ampicillin | Backbone Marker:Novagen; Vector Backbone:pBACgus; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin | aa1867-2186, C2024S/C2025S | 2026-08-15 01:14:36 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
