Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

743,786 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pQCXIP HBT-Ubiquitin
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26865 ubiquitin Saccharomyces cerevisiae Ampicillin PMID:18781797 Backbone Marker:Clonetech; Backbone Size:7200; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-10-17 02:44:07 2
pUAS myc Gr66a
 
Resource Report
Resource Website 		RRID:Addgene_26861 Gr66 gustatory receptor Drosophila melanogaster Ampicillin PMID:16979558 Backbone Size:0; Vector Backbone:pP[UAS-myc]; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-17 02:44:07 0
pcasper4 p [7-Gr66a-]
 
Resource Report
Resource Website 		RRID:Addgene_26860 Gr66 gustatory receptor Drosophila melanogaster Ampicillin PMID:16979558 Backbone Size:7855; Vector Backbone:pCaSper4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Partial deletion of Gr66a (see associated paper listed below for details), but contains genes CG7066 and CG7188, which neighbor Gr66a Addgene 2026-10-17 02:44:07 0
pFA6a-HBH-TRP1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26874 HBH tag Ampicillin PMID:16823883 Backbone Size:3700; Vector Backbone:pFA6aTRP1; Vector Types:PCR tagging yeast; Bacterial Resistance:Ampicillin Addgene 2026-10-17 02:44:07 1
pFA6a-HTB-hphMX4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26876 HTB tag Ampicillin PMID:16823883 Backbone Size:4400; Vector Backbone:pFA6ahphMX4; Vector Types:PCR tagging yeast; Bacterial Resistance:Ampicillin Addgene 2026-10-17 02:44:07 1
pFA6a-HTB-kanMX6
 
Resource Report
Resource Website 		RRID:Addgene_26875 HTB tag Ampicillin PMID:16823883 Backbone Size:4100; Vector Backbone:pFA6akanMX6; Vector Types:PCR tagging yeast; Bacterial Resistance:Ampicillin Addgene 2026-10-17 02:44:07 0
CBFRE (mt) EGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26870 CBFRE Ampicillin PMID:17721509 CBFRE: four (mutated) CBF1-binding elements from EBV (see Hsieh MCB 1996, 16:952) and the basal simian virus 40 (SV40) promoter upstream of EGFP. The sequence of the mutated CBF1 binding element is (GATCTGGTGTAAA CACGGGCTTGGAAAAAATTTATG). Backbone Marker:Gaiano Lab; Backbone Size:0; Vector Backbone:CBFRE-EGFP; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin The mutated CBF1 binding site: GATCTGGTGTAAA CACGGGCTTGGAAAAAATTTATG Addgene 2026-10-17 02:44:07 2
pFA6a-HBH-kanMX6
 
Resource Report
Resource Website 		RRID:Addgene_26872 HBH tag Ampicillin PMID:16823883 Backbone Size:4100; Vector Backbone:pFA6akanMX6; Vector Types:PCR tagging yeast; Bacterial Resistance:Ampicillin Addgene 2026-10-17 02:44:07 0
pAAV-Ef1a-DIO eNpHR 3.0-EYFP
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_26966 eNpHR 3.0 Homo sapiens Ampicillin PMID:20303157 This plasmid contains the human elongation factor-1a promoter. Golgi export trafficking signal (TS) sequence is KSRITSEGEYIPLDQIDINV. ER export sequence is FCYENEV. For additional information please visit - http://www.optogenetics.org Backbone Size:5609; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin ER export at 3' end of gene. Trafficking signal (TS) in between gene and fluorophore. Addgene 2026-10-17 02:44:07 90
pAAV-Ef1a-DIO ChETA-EYFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26968 hChR2(E123T/H134R)-EYFP Homo sapiens Ampicillin PMID:20081849 This plasmid contains the human elongation factor-1a promoter. For additional information please visit - http://www.optogenetics.org Backbone Marker:Invitrogen; Backbone Size:5587; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin E123T, H134R Addgene 2026-10-17 02:44:07 19
Sgf73(1-106)/PET32a
 
Resource Report
Resource Website 		RRID:Addgene_26962 Sgf73(1-106) Saccharomyces cerevisiae Ampicillin PMID:20395473 Backbone Size:5900; Vector Backbone:PET32a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin with TEV site to cleave the N-terminal his+Trx tag Addgene 2026-10-17 02:44:07 0
MSCV-PM mir shLEF1 b
 
Resource Report
Resource Website 		RRID:Addgene_27018 mir LEF1 1b Ampicillin PMID:19576624 shRNA sequence is 5'-GAGTTATTCCGGGTACATA Backbone Size:6300; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin Addgene 2026-10-17 02:44:08 0
Sus1/PRSF
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26961 Sus1 Saccharomyces cerevisiae Kanamycin PMID:20395473 Backbone Size:3669; Vector Backbone:PRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-17 02:44:07 1
MSCV-PM mir shLEF1 a
 
Resource Report
Resource Website 		RRID:Addgene_27019 mir LEF1 3a Ampicillin PMID:19576624 shRNA sequence is 5'-GTTGCTGAGTGTACTCTAA Backbone Size:6300; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin Addgene 2026-10-17 02:44:08 0
Sgf73_Sgf11/PCDFDuet
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26964 sgf11 Saccharomyces cerevisiae Spectinomycin and Streptomycin PMID:20395473 sgf 73(1-96) cloned in the second frame by NdeI+BglII for coexpression Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin Addgene 2026-10-17 02:44:07 1
pRS-puro shNEDD4L #1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_27016 shRNA NEDD4L #1 Homo sapiens Ampicillin PMID:19917253 shRNA sequence - 5'-gatccccGCTAGACTGTGGATTGAGTttcaagagaACTCAATCCACAGTCTAGCtttttggaaa Backbone Size:6401; Vector Backbone:pRetroSuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin Addgene 2026-10-17 02:44:08 3
Sgf11/pCDF
 
Resource Report
Resource Website 		RRID:Addgene_26960 sgf11 Saccharomyces cerevisiae Spectinomycin PMID:20395473 Backbone Marker:novagen; Backbone Size:3620; Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin Addgene 2026-10-17 02:44:07 0
TAp63gamma-(3X)HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26977 TAp63gamma Homo sapiens Ampicillin PMID:17399686 Backbone Marker:Invitrogen; Backbone Size:5597; Vector Backbone:pcDNA3.1 Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-17 02:44:08 2
pAAV-hSyn-hChR2(H134R)-mCherry
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26976 hChR2(H134R) Homo sapiens Ampicillin This plasmid contains the human synapsin I promoter. For additional information please visit - http://www.optogenetics.org Backbone Marker:Invitrogen; Backbone Size:4568; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin H134R Addgene 2026-10-17 02:44:08 25
pAAV-hSyn-hChR2(H134R)-EYFP
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_26973 hChR2(H134R) Homo sapiens Ampicillin This plasmid contains the human synapsin I promoter. For additional information please visit - http://www.optogenetics.org Backbone Marker:Invitrogen; Backbone Size:4574; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin H134R Addgene 2026-10-17 02:44:08 166

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET Webinar: Gene Regulatory Network Analysis in Texera

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

dkNET community events and announcements in October, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch