Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 18 showing 341 ~ 360 out of 32,424 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_110565

    This resource has 1+ mentions.

http://www.addgene.org/110565

Species: Mus musculus
Genetic Insert: Talin 1
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_110565 Copy   

    • RRID:Addgene_110603

    This resource has 1+ mentions.

http://www.addgene.org/110603

Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29608282

Proper citation: RRID:Addgene_110603 Copy   

    • RRID:Addgene_11059

    This resource has 1+ mentions.

http://www.addgene.org/11059

Species: Homo sapiens
Genetic Insert: Paf1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGCCCACCATCCAG 3' and 5' CCGCTCGAGTCAGTCACTGTCACTATCAGCTTCACTG 3'

Proper citation: RRID:Addgene_11059 Copy   

    • RRID:Addgene_11055

    This resource has 1+ mentions.

http://www.addgene.org/11055

Species: Mus musculus
Genetic Insert: HDAC1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15060137
Comments: Addgene sequencing data finds T189A and D332G substitutions. These are not known to affect function.

Proper citation: RRID:Addgene_11055 Copy   

    • RRID:Addgene_11054

    This resource has 1+ mentions.

http://www.addgene.org/11054

Species: Mus musculus
Genetic Insert: HDAC1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15060137

Proper citation: RRID:Addgene_11054 Copy   

    • RRID:Addgene_11053

    This resource has 1+ mentions.

http://www.addgene.org/11053

Species: Mus musculus
Genetic Insert: HDAC1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15060137
Comments: pCIG drives simultaneous expression of GFP and inserted genes by virtue of an internal ribosome entry site.

Proper citation: RRID:Addgene_11053 Copy   

http://www.addgene.org/110558

Species: Other
Genetic Insert: lacIq-Ptac
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18T-miniTn7T-gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27613678

Proper citation: RRID:Addgene_110558 Copy   

http://www.addgene.org/110559

Species: Other
Genetic Insert: rhaSR-PrhaBAD
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18T-miniTn7T-gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27613678

Proper citation: RRID:Addgene_110559 Copy   

    • RRID:Addgene_11060

    This resource has 1+ mentions.

http://www.addgene.org/11060

Species: Homo sapiens
Genetic Insert: Rtf1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CCCAAGCTTATGAAGAAACAGGCCAACA 3' and 5' CCGCTCGAGAATAAGCCCTCGTCGTTT 3'

Proper citation: RRID:Addgene_11060 Copy   

    • RRID:Addgene_1106

    This resource has 1+ mentions.

http://www.addgene.org/1106

Species: bacteria
Genetic Insert: bacterial luciferase
Vector Backbone Description: Backbone Size:0; Vector Backbone:unknown; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7984243
Comments: His as a selectable marker

Proper citation: RRID:Addgene_1106 Copy   

    • RRID:Addgene_110533

    This resource has 1+ mentions.

http://www.addgene.org/110533

Species: Saccharomyces cerevisiae
Genetic Insert: NAB3
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22564898

Proper citation: RRID:Addgene_110533 Copy   

    • RRID:Addgene_110598

    This resource has 1+ mentions.

http://www.addgene.org/110598

Species: Synthetic
Genetic Insert: mRFP dropout (RSF1010 origin)
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29608282

Proper citation: RRID:Addgene_110598 Copy   

    • RRID:Addgene_110732

    This resource has 1+ mentions.

http://www.addgene.org/110732

Species: Homo sapiens
Genetic Insert: BRAFV600E IRES H2B-mOrange2
Vector Backbone Description: Vector Backbone:pHIV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29990501

Proper citation: RRID:Addgene_110732 Copy   

    • RRID:Addgene_110731

    This resource has 1+ mentions.

http://www.addgene.org/110731

Species: Homo sapiens
Genetic Insert: p14ARF IRES H2B-mOrange2
Vector Backbone Description: Vector Backbone:pHIV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29990501
Comments: Addgene sequencing detected a potentially mixed population, with a C to T nucleotide change that would cause a T8I mutation within the CDKN2A insert. Please screen multiple clones to ensure that the correct (C) one is isolated before proceeding with downstream work.

Proper citation: RRID:Addgene_110731 Copy   

    • RRID:Addgene_110736

    This resource has 1+ mentions.

http://www.addgene.org/110736

Species: Homo sapiens
Genetic Insert: CDKN2A gRNA
Vector Backbone Description: Vector Backbone:pEN35; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29990501

Proper citation: RRID:Addgene_110736 Copy   

    • RRID:Addgene_110737

    This resource has 1+ mentions.

http://www.addgene.org/110737

Species: Homo sapiens
Genetic Insert: CDKN2A gRNA
Vector Backbone Description: Vector Backbone:pEN35; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29990501

Proper citation: RRID:Addgene_110737 Copy   

    • RRID:Addgene_110739

    This resource has 1+ mentions.

http://www.addgene.org/110739

Vector Backbone Description: Backbone Size:5450; Vector Backbone:pFL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin and Gentamicin
Defining Citation: PMID:17117155

Proper citation: RRID:Addgene_110739 Copy   

    • RRID:Addgene_110722

    This resource has 1+ mentions.

http://www.addgene.org/110722

Vector Backbone Description: Backbone Size:8000; Vector Backbone:pLVX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27028654

Proper citation: RRID:Addgene_110722 Copy   

    • RRID:Addgene_110720

    This resource has 1+ mentions.

http://www.addgene.org/110720

Vector Backbone Description: Backbone Size:8000; Vector Backbone:pLVX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27028654

Proper citation: RRID:Addgene_110720 Copy   

    • RRID:Addgene_110726

    This resource has 1+ mentions.

http://www.addgene.org/110726

Species: Homo sapiens
Genetic Insert: Pro-SBP-mGFP-COL1A1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8102; Vector Backbone:pLVX-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30587510
Comments: See attached PDF for full descritions

Proper citation: RRID:Addgene_110726 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

NIDDK Early Research Partnership Engagement Challenge

Funding Opportunity: National NIH K12 DiabDocs Career Development Program

NIH Data Sharing and Reuse Seminar- Sex Differences in Acute Kidney Injury Risk and Outcomes: Insights from MIMIC-III and MIMIC-IV

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch