Plasmids   Select Another Resource Report Type

http://www.addgene.org/159403

Species: Synthetic
Genetic Insert: pr.T5-LacO-6xHis-sfGFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32948587
Comments: Please note: This plasmid exists as a multimer. This is not expected to impact the end function of the plasmid. Please refer to the Addgene Blog post on multimers for more information: https://blog.addgene.org/plasmids-101-dimers-and-multimers

Proper citation: RRID:Addgene_159403 Copy   

•   Source: Addgene

http://www.addgene.org/159404

Species: Synthetic
Genetic Insert: pr.T7-sfGFP
Vector Backbone Description: Backbone Marker:iGEM parts registry; Vector Backbone:pSB1A3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32948587

Proper citation: RRID:Addgene_159404 Copy   

•   Source: Addgene

http://www.addgene.org/159401

Species: Synthetic
Genetic Insert: pr.J23117/J23106-sfGFP
Vector Backbone Description: Backbone Marker:iGEM parts registry; Vector Backbone:pSB1A3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32948587

Proper citation: RRID:Addgene_159401 Copy   

•   Source: Addgene

http://www.addgene.org/159522

Species: Saccharomyces cerevisiae
Genetic Insert: Ufd2
Vector Backbone Description: Backbone Size:7540; Vector Backbone:pRS425-Gal1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_159522 Copy   

•   Source: Addgene

http://www.addgene.org/159488

Species: Synthetic
Genetic Insert: Termination Module:Linear-2_PolyU(2)
Vector Backbone Description: Vector Backbone:pAV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33811918

Proper citation: RRID:Addgene_159488 Copy   

•   Source: Addgene

http://www.addgene.org/159486

Species: Synthetic
Genetic Insert: Termination Module:Linear-1_PolyU(8)
Vector Backbone Description: Vector Backbone:pAV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33811918

Proper citation: RRID:Addgene_159486 Copy   

•   Source: Addgene

http://www.addgene.org/159483

Species: Synthetic
Genetic Insert: Termination Module:Linear-1_PolyU(5)
Vector Backbone Description: Vector Backbone:pAV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33811918

Proper citation: RRID:Addgene_159483 Copy   

•   Source: Addgene

http://www.addgene.org/159482

Species: Synthetic
Genetic Insert: Termination Module:Linear-1_PolyU(4)
Vector Backbone Description: Vector Backbone:pAV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33811918

Proper citation: RRID:Addgene_159482 Copy   

•   Source: Addgene

http://www.addgene.org/159418

Species: Synthetic
Genetic Insert: thermostable GFP (TGP)
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33303987
Comments: Full sequence is provided but the depositors have only verified the sequence of the multi-cloning site and the TGP-encoding region by DNA sequencing.

Proper citation: RRID:Addgene_159418 Copy   

•   Source: Addgene

http://www.addgene.org/159419

Species: Synthetic
Genetic Insert: thermostable GFP (TGP)
Vector Backbone Description: Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33303987
Comments: Full sequence is provided but the depositors have only verified the sequence of the multi-cloning site and the TGP-encoding region by DNA sequencing.

Proper citation: RRID:Addgene_159419 Copy   

•   Source: Addgene

http://www.addgene.org/159416

Species: Nicotiana benthamiana
Genetic Insert: NbPT5b Promoter
Vector Backbone Description: Backbone Marker:47997 (Sylvestre Marillonnet); Backbone Size:2251; Vector Backbone:pICH41295; Vector Types:Bacterial Expression, pUC19-derived; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34260583

Proper citation: RRID:Addgene_159416 Copy   

•   Source: Addgene

http://www.addgene.org/159414

Species: Medicago truncatula
Genetic Insert: MtPT4 Promoter
Vector Backbone Description: Backbone Marker:47997 (Sylvestre Marillonnet); Backbone Size:2251; Vector Backbone:pICH41295; Vector Types:Bacterial Expression, pUC19-derived; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34260583

Proper citation: RRID:Addgene_159414 Copy   

•   Source: Addgene

http://www.addgene.org/159410

Species: Mus musculus
Genetic Insert: pr.tet-BDNF (Bdnf, Mouse)
Vector Backbone Description: Backbone Marker:iGEM parts registry; Vector Backbone:pSB1A3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32948587

Proper citation: RRID:Addgene_159410 Copy   

•   Source: Addgene

http://www.addgene.org/159498

Species: Synthetic
Genetic Insert: Termination Module:Linear-1_PolyU(4)_HairpinDistance(10)nts
Vector Backbone Description: Vector Backbone:pAV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33811918

Proper citation: RRID:Addgene_159498 Copy   

•   Source: Addgene

http://www.addgene.org/159411

Species: Mus musculus
Genetic Insert: pr.J23101-BDNF (Bdnf, Mouse)
Vector Backbone Description: Backbone Marker:iGEM parts registry; Vector Backbone:pSB1A3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32948587

Proper citation: RRID:Addgene_159411 Copy   

•   Source: Addgene

http://www.addgene.org/159499

Species: Synthetic
Genetic Insert: Termination Module:Linear-2_PolyU(1)_HairpinDistance(0)nts
Vector Backbone Description: Vector Backbone:pAV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33811918

Proper citation: RRID:Addgene_159499 Copy   

•   Source: Addgene

http://www.addgene.org/159495

Species: Synthetic
Genetic Insert: Termination Module:Linear-1_PolyU(1)_HairpinDistance(0)nts
Vector Backbone Description: Vector Backbone:pAV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33811918

Proper citation: RRID:Addgene_159495 Copy   

•   Source: Addgene

http://www.addgene.org/159493

Species: Synthetic
Genetic Insert: Termination Module:Linear-2_PolyU(7)
Vector Backbone Description: Vector Backbone:pAV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33811918

Proper citation: RRID:Addgene_159493 Copy   

•   Source: Addgene

http://www.addgene.org/159391

Species: Mus musculus
Genetic Insert: gRNA library targeting mouse core intrinsic immune evasion genes
Vector Backbone Description: Backbone Marker:Jason Moffat; Vector Backbone:pLCKO2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32968282

Proper citation: RRID:Addgene_159391 Copy   

•   Source: Addgene

http://www.addgene.org/159427

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4682; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33971243
Comments: - This vector is designed to avoid adding non-native amino acid residues to the protein of interest, following TEV protease cleavage of the N-terminal purification tag. Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTCTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, AGTACTTCTCGACAA, to the 5' end of the PCR REVERSE primer. - The sequence of the N-terminus will be MGSS + His10 + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminus of the protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - An unwanted BseRI site was removed from the parent pFastBac1 vector by introducing a silent mutation (CTC to CTG) in a leucine codon in the gentamicin-resistance gene. - To identify colonies containing a cloned insert, used the primers PFASTBAC1F (CTAGTGGTTGGCTACGTATACTCCG) and PFASTBAC1R (GGACAAACCACAACTAGAATGCAGTG). - To verify the PCR-generated insert sequence, use sequencing primers POLYHEDF (AAATGATAACCATCTCGC), SV40PAR (GAAATTTGTGATGCTATTGC). - To verify Tn7-based incorporation of the expression construct into the bacmid DNA in the E. coli strain DH10Bac, use PCR primers BACM13F (CCCAGTCACGACGTTGTAAAACG) and BACM13R (AGCGGATAACAATTTCACACAGG). A bacmid containing the correct insert has a PCR product size of ~2300 base pairs plus the length of the added insert.

Proper citation: RRID:Addgene_159427 Copy   

•   Source: Addgene