Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:bleocin (zeocin) (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

566 Results - per page

Show More Columns | Download 566 Result(s)

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
HA-MBP-TEVpCS-ADGRG1 CTF-FLAG
 
Resource Report
Resource Website
RRID:Addgene_217699 ADGRG1 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-382 2026-08-15 01:29:26 0
HA-MBP-TEVpCS-ADGRG2 CTFdeltaTA-FLAG
 
Resource Report
Resource Website
RRID:Addgene_217733 ADGRG2 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-612 2026-08-15 01:29:26 0
HA-MBP-TEVpCS-ADGRF4 CTFdeltaTA-FLAG
 
Resource Report
Resource Website
RRID:Addgene_217730 ADGRF4 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-390 2026-08-15 01:29:26 0
HA-MBP-TEVpCS-ADGRF4 CTF-FLAG
 
Resource Report
Resource Website
RRID:Addgene_217697 ADGRF4 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-384 2026-08-15 01:29:27 0
HA-MBP-TEVpCS-ADGRF5 CTFdeltaTA-FLAG
 
Resource Report
Resource Website
RRID:Addgene_217731 ADGRF5 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-996 2026-08-15 01:29:26 0
HA-MBP-TEVpCS-ADGRL3 CTFdeltaTA-FLAG
 
Resource Report
Resource Website
RRID:Addgene_217741 ADGRL3 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-847 2026-08-15 01:29:27 0
HA-MBP-TEVpCS-ADGRL4 CTFdeltaTA-FLAG
 
Resource Report
Resource Website
RRID:Addgene_217742 ADGRL4 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-412 2026-08-15 01:29:27 0
hPLD3-sgRNA-Cas9_mcherry
 
Resource Report
Resource Website
RRID:Addgene_199342 hSpCas9 Bleocin (Zeocin) Backbone Marker:adapted from addgene #75161; Backbone Size:6800; Vector Backbone:lentiCRISPRv2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:29:40 0
hPLD4-sgRNA-Cas9_mcherry
 
Resource Report
Resource Website
RRID:Addgene_199343 hSpCas9 Bleocin (Zeocin) Backbone Marker:adapted from addgene #99154; Backbone Size:6800; Vector Backbone:lentiCRISPRv2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Bleocin (Zeocin) sgRNA: accagtagtatgaagccacg 2026-08-15 01:29:40 0
mPLD3-sgRNA-Cas9-mcherry
 
Resource Report
Resource Website
RRID:Addgene_199700 hSpCas9 Bleocin (Zeocin) Backbone Marker:adapted from addgene #99154; Backbone Size:6800; Vector Backbone:lentiCRISPRv2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:29:40 0
pICOZ-MAG[EF1α-CD19 CD28Z]
 
Resource Report
Resource Website
RRID:Addgene_218333 CD19 CAR mammalian expression cassette Synthetic Bleocin (Zeocin) PMID:38843831 Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:31:04 0
pICOZ-SB100X[EF1α-HER1 CD28Z]
 
Resource Report
Resource Website
RRID:Addgene_218334 HER1 CAR mammalian expression cassette Synthetic Bleocin (Zeocin) PMID:38843831 Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:31:04 0
pICOZ-MAG[EF1α-HER1 4-1BB]
 
Resource Report
Resource Website
RRID:Addgene_218331 HER1 CAR mammalian expression cassette Synthetic Bleocin (Zeocin) PMID:38843831 Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:31:04 0
pICOZ-MAG-M235Q
 
Resource Report
Resource Website
RRID:Addgene_218299 M235Q mutant of MAG transposase Synthetic Bleocin (Zeocin) PMID:38843831 Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:31:04 0
pICOZ-SB100X[EF1α-CD19 4-1BB-eGFP]
 
Resource Report
Resource Website
RRID:Addgene_218343 CD19 CAR mammalian expression cassette Synthetic Bleocin (Zeocin) PMID:38843831 Vector Backbone: pICOZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:31:04 0
pICOZ-MAG-H181A
 
Resource Report
Resource Website
RRID:Addgene_218300 H181A mutant of MAG transposase Synthetic Bleocin (Zeocin) PMID:38843831 Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:31:04 0
pICOZ-MAG-H181V
 
Resource Report
Resource Website
RRID:Addgene_218301 H181V mutant of MAG transposase Synthetic Bleocin (Zeocin) PMID:38843831 Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:31:04 0
pICOZ-SB100X[EF1α-HER1 4-1BB]
 
Resource Report
Resource Website
RRID:Addgene_218330 HER1 CAR mammalian expression cassette Synthetic Bleocin (Zeocin) PMID:38843831 Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:31:04 0
pICOZ-SB100X[EF1α-CD19 4-1BB]
 
Resource Report
Resource Website
RRID:Addgene_218328 CD19 CAR mammalian expression cassette Synthetic Bleocin (Zeocin) PMID:38843831 Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:31:04 0
pICOZ-MAG[EF1α-CD19 4-1BB]
 
Resource Report
Resource Website
RRID:Addgene_218329 CD19 CAR mammalian expression cassette Synthetic Bleocin (Zeocin) PMID:38843831 Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:31:04 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.