Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
HA-MBP-TEVpCS-ADGRG1 CTF-FLAG Resource Report Resource Website |
RRID:Addgene_217699 | ADGRG1 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-382 | 2026-08-15 01:29:26 | 0 |
|
HA-MBP-TEVpCS-ADGRG2 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217733 | ADGRG2 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-612 | 2026-08-15 01:29:26 | 0 |
|
HA-MBP-TEVpCS-ADGRF4 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217730 | ADGRF4 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-390 | 2026-08-15 01:29:26 | 0 |
|
HA-MBP-TEVpCS-ADGRF4 CTF-FLAG Resource Report Resource Website |
RRID:Addgene_217697 | ADGRF4 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-384 | 2026-08-15 01:29:27 | 0 |
|
HA-MBP-TEVpCS-ADGRF5 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217731 | ADGRF5 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-996 | 2026-08-15 01:29:26 | 0 |
|
HA-MBP-TEVpCS-ADGRL3 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217741 | ADGRL3 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-847 | 2026-08-15 01:29:27 | 0 |
|
HA-MBP-TEVpCS-ADGRL4 CTFdeltaTA-FLAG Resource Report Resource Website |
RRID:Addgene_217742 | ADGRL4 | Homo sapiens | Bleocin (Zeocin) | PMID:38608683 | Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. | Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Deletion of residues 1-412 | 2026-08-15 01:29:27 | 0 |
|
hPLD3-sgRNA-Cas9_mcherry Resource Report Resource Website |
RRID:Addgene_199342 | hSpCas9 | Bleocin (Zeocin) | Backbone Marker:adapted from addgene #75161; Backbone Size:6800; Vector Backbone:lentiCRISPRv2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:29:40 | 0 | ||||
|
hPLD4-sgRNA-Cas9_mcherry Resource Report Resource Website |
RRID:Addgene_199343 | hSpCas9 | Bleocin (Zeocin) | Backbone Marker:adapted from addgene #99154; Backbone Size:6800; Vector Backbone:lentiCRISPRv2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Bleocin (Zeocin) | sgRNA: accagtagtatgaagccacg | 2026-08-15 01:29:40 | 0 | |||
|
mPLD3-sgRNA-Cas9-mcherry Resource Report Resource Website |
RRID:Addgene_199700 | hSpCas9 | Bleocin (Zeocin) | Backbone Marker:adapted from addgene #99154; Backbone Size:6800; Vector Backbone:lentiCRISPRv2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:29:40 | 0 | ||||
|
pICOZ-MAG[EF1α-CD19 CD28Z] Resource Report Resource Website |
RRID:Addgene_218333 | CD19 CAR mammalian expression cassette | Synthetic | Bleocin (Zeocin) | PMID:38843831 | Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:31:04 | 0 | ||
|
pICOZ-SB100X[EF1α-HER1 CD28Z] Resource Report Resource Website |
RRID:Addgene_218334 | HER1 CAR mammalian expression cassette | Synthetic | Bleocin (Zeocin) | PMID:38843831 | Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:31:04 | 0 | ||
|
pICOZ-MAG[EF1α-HER1 4-1BB] Resource Report Resource Website |
RRID:Addgene_218331 | HER1 CAR mammalian expression cassette | Synthetic | Bleocin (Zeocin) | PMID:38843831 | Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:31:04 | 0 | ||
|
pICOZ-MAG-M235Q Resource Report Resource Website |
RRID:Addgene_218299 | M235Q mutant of MAG transposase | Synthetic | Bleocin (Zeocin) | PMID:38843831 | Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:31:04 | 0 | ||
|
pICOZ-SB100X[EF1α-CD19 4-1BB-eGFP] Resource Report Resource Website |
RRID:Addgene_218343 | CD19 CAR mammalian expression cassette | Synthetic | Bleocin (Zeocin) | PMID:38843831 | Vector Backbone: pICOZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:31:04 | 0 | ||
|
pICOZ-MAG-H181A Resource Report Resource Website |
RRID:Addgene_218300 | H181A mutant of MAG transposase | Synthetic | Bleocin (Zeocin) | PMID:38843831 | Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:31:04 | 0 | ||
|
pICOZ-MAG-H181V Resource Report Resource Website |
RRID:Addgene_218301 | H181V mutant of MAG transposase | Synthetic | Bleocin (Zeocin) | PMID:38843831 | Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:31:04 | 0 | ||
|
pICOZ-SB100X[EF1α-HER1 4-1BB] Resource Report Resource Website |
RRID:Addgene_218330 | HER1 CAR mammalian expression cassette | Synthetic | Bleocin (Zeocin) | PMID:38843831 | Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:31:04 | 0 | ||
|
pICOZ-SB100X[EF1α-CD19 4-1BB] Resource Report Resource Website |
RRID:Addgene_218328 | CD19 CAR mammalian expression cassette | Synthetic | Bleocin (Zeocin) | PMID:38843831 | Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:31:04 | 0 | ||
|
pICOZ-MAG[EF1α-CD19 4-1BB] Resource Report Resource Website |
RRID:Addgene_218329 | CD19 CAR mammalian expression cassette | Synthetic | Bleocin (Zeocin) | PMID:38843831 | Vector Backbone: pICOZ; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:31:04 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.