Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,397 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pBbA5k-EPL45
 
Resource Report
Resource Website 		RRID:Addgene_45413 PFL_1028 Synthetic Kanamycin PMID:21556065 Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:23 0
pBbA5k-EPL52
 
Resource Report
Resource Website 		RRID:Addgene_45415 Rmet_4866 Synthetic Kanamycin PMID:21556065 Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:23 0
pBbA5k-EPL48
 
Resource Report
Resource Website 		RRID:Addgene_45414 PFL_1158 Synthetic Kanamycin PMID:21556065 Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions. Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:23 0
PL2x2_5
 
Resource Report
Resource Website 		RRID:Addgene_45491 PL2x2_5 Synthetic Kanamycin Backbone Size:5370; Vector Backbone:pET29b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin changed E30Y of Di-IV_5_PL2x2_6 2026-08-15 01:15:24 0
FR55
 
Resource Report
Resource Website 		RRID:Addgene_45490 FR55 Synthetic Kanamycin Backbone Size:5370; Vector Backbone:pET29b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin changed F14L and added Gly at N-terminus of Di-I_5_FR28 2026-08-15 01:15:24 0
CMV-CAR-GECO1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_45493 CAR-GECO1 Synthetic Ampicillin PMID:23452507 Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R-GECO1 E163V/I166V/V174T/M176I/F222I/A302P 2026-08-15 01:15:24 3
CMV-R-GECO1.2
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_45494 R-GECO1.2 Synthetic Ampicillin PMID:23452507 Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R-GECO1 M164R/I166V/V174L/F222L/N267S/S270T/I330M/L419I 2026-08-15 01:15:24 25
FDA60
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_45606 FDA60 Synthetic Ampicillin Backbone Size:5358; Vector Backbone:peT21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:25 1
CMV-O-GECO1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46025 O-GECO1 Synthetic Ampicillin PMID:23452507 Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R-GECO1 N45I/A73V/S142P/M146R/M223T/M339L/K378R/E386V/K397N 2026-08-15 01:15:28 2
CMV-mito-CAR-GECO1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_46022 CAR-GECO1 Synthetic Ampicillin PMID:23452507 The vector of the CMV-mito-CAR-GECO1 is based on the mitATeam1.03 pcDNA plasmid reported here: (http://www.pnas.org/content/106/37/15651.abstract). Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R-GECO1 E163V/I166V/V174T/M176I/F222I/A302P 2026-08-15 01:15:28 14
CMV-mito-R-GECO1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_46021 R-GECO1 Synthetic Ampicillin PMID:23452507 The vector of the CMV-mito-R-GECO1 is based on the mitATeam1.03 pcDNA plasmid reported here: (http://www.pnas.org/content/106/37/15651.abstract). Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Substitutions relative to the mApple-derived analogue of GCaMP3: T47A/L60P/E61V/S63V/E64S/R81G/K83R/Y134C/M158L/N164aD/V228A/ S290P/I366F/K380N/S404G/N414D/E430V 2026-08-15 01:15:28 22
pCAG-TALEN-G-pA
 
Resource Report
Resource Website 		RRID:Addgene_45962 TALEN Synthetic Ampicillin Backbone Size:2500; Vector Backbone:pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:27 0
pGR-L3S2P00
 
Resource Report
Resource Website 		RRID:Addgene_46005 L3S2P00 Terminator Synthetic Ampicillin PMID:23727987 Backbone Size:5047; Vector Backbone:pGR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:15:28 0
pENTR-L4-pTF-L1R
 
Resource Report
Resource Website 		RRID:Addgene_45954 pTF promoter Synthetic Kanamycin PMID:21761975 More information can be found at http://medweb2.unige.ch/salmon/lentilab/lentivectors.html Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pDONRP4P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:15:27 0
PU6::klp-12_sgRNA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46170 klp-12 targeting sgRNA Synthetic Ampicillin PMID:23817069 gRNA target sequence GATCCACAAGTTACAATTGG Backbone Size:2641; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 7
PU6::unc-119_sgRNA
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_46169 unc-119 targeting sgRNA Synthetic Ampicillin PMID:23817069 gRNA target sequence GAATTTTCTGAAATTAAAGA Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:30 29
Peft-3::cas9-SV40_NLS::tbb-2 3'UTR
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_46168 codon optimized Cas9_SV40 NLS with intron Synthetic Ampicillin PMID:23817069 Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin intron inserted at position 3113-3163, and SV40 NLS inserted from position 5192-5227 2026-08-15 01:15:29 47
pPTQF#7-hsp70
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_46136 QF#7 Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:5176; Vector Backbone:pPTGAL4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 1
pCasper4-tubulin-IVS-Syn21-QSco-p10
 
Resource Report
Resource Website 		RRID:Addgene_46132 QSco Synthetic Ampicillin PMID:25581800 Please note that Addgene's sequencing results found a single nucleotide mismatch at bp# 5036 in the tubulin promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid. Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:11431; Vector Backbone:pCasper4-tubulinP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0
pAC-2-G4BDMD-QFAD
 
Resource Report
Resource Website 		RRID:Addgene_46091 G4BDMD-QFAD Synthetic Ampicillin PMID:25581800 Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:29 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch