Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: PFL_1028
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45413 Copy
Species: Synthetic
Genetic Insert: Rmet_4866
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45415 Copy
Species: Synthetic
Genetic Insert: PFL_1158
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45414 Copy
Species: Synthetic
Genetic Insert: PL2x2_5
Vector Backbone Description: Backbone Size:5370; Vector Backbone:pET29b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_45491 Copy
Species: Synthetic
Genetic Insert: FR55
Vector Backbone Description: Backbone Size:5370; Vector Backbone:pET29b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_45490 Copy
Species: Synthetic
Genetic Insert: CAR-GECO1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452507
Proper citation: RRID:Addgene_45493 Copy
Species: Synthetic
Genetic Insert: R-GECO1.2
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452507
Proper citation: RRID:Addgene_45494 Copy
Species: Synthetic
Genetic Insert: FDA60
Vector Backbone Description: Backbone Size:5358; Vector Backbone:peT21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45606 Copy
Species: Synthetic
Genetic Insert: O-GECO1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452507
Proper citation: RRID:Addgene_46025 Copy
Species: Synthetic
Genetic Insert: CAR-GECO1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452507
Comments: The vector of the CMV-mito-CAR-GECO1 is based on the mitATeam1.03 pcDNA plasmid reported here:
(http://www.pnas.org/content/106/37/15651.abstract).
Proper citation: RRID:Addgene_46022 Copy
Species: Synthetic
Genetic Insert: R-GECO1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452507
Comments: The vector of the CMV-mito-R-GECO1 is based on the mitATeam1.03 pcDNA plasmid reported here:
(http://www.pnas.org/content/106/37/15651.abstract).
Proper citation: RRID:Addgene_46021 Copy
Species: Synthetic
Genetic Insert: TALEN
Vector Backbone Description: Backbone Size:2500; Vector Backbone:pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45962 Copy
Species: Synthetic
Genetic Insert: L3S2P00 Terminator
Vector Backbone Description: Backbone Size:5047; Vector Backbone:pGR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727987
Proper citation: RRID:Addgene_46005 Copy
Species: Synthetic
Genetic Insert: pTF promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pDONRP4P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21761975
Comments: More information can be found at http://medweb2.unige.ch/salmon/lentilab/lentivectors.html
Proper citation: RRID:Addgene_45954 Copy
Species: Synthetic
Genetic Insert: klp-12 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GATCCACAAGTTACAATTGG
Proper citation: RRID:Addgene_46170 Copy
Species: Synthetic
Genetic Insert: unc-119 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GAATTTTCTGAAATTAAAGA
Proper citation: RRID:Addgene_46169 Copy
Species: Synthetic
Genetic Insert: codon optimized Cas9_SV40 NLS with intron
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_46168 Copy
Species: Synthetic
Genetic Insert: QF#7
Vector Backbone Description: Backbone Size:5176; Vector Backbone:pPTGAL4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46136 Copy
Species: Synthetic
Genetic Insert: QSco
Vector Backbone Description: Backbone Size:11431; Vector Backbone:pCasper4-tubulinP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please note that Addgene's sequencing results found a single nucleotide mismatch at bp# 5036 in the tubulin promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid.
Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46132 Copy
Species: Synthetic
Genetic Insert: G4BDMD-QFAD
Vector Backbone Description: Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46091 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
