Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 132 showing 2621 ~ 2640 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_177716

http://www.addgene.org/177716

Species: Other
Genetic Insert: hFluc
Vector Backbone Description: Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34857875
Comments:

Proper citation: RRID:Addgene_177716 Copy   


  • RRID:Addgene_177715

http://www.addgene.org/177715

Species: Other
Genetic Insert: hFluc
Vector Backbone Description: Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34857875
Comments:

Proper citation: RRID:Addgene_177715 Copy   


  • RRID:Addgene_177718

http://www.addgene.org/177718

Species: Homo sapiens
Genetic Insert: alpha-1-antitrypsin
Vector Backbone Description: Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34857875
Comments:

Proper citation: RRID:Addgene_177718 Copy   


  • RRID:Addgene_177719

http://www.addgene.org/177719

Species: Homo sapiens
Genetic Insert: alpha-1-antitrypsin
Vector Backbone Description: Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34857875
Comments:

Proper citation: RRID:Addgene_177719 Copy   


http://www.addgene.org/177673

Species: Synthetic
Genetic Insert: DREADD Gi-mCherry
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4591; Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, INTRSECT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:
Comments:

Proper citation: RRID:Addgene_177673 Copy   


  • RRID:Addgene_169789

    This resource has 1+ mentions.

http://www.addgene.org/169789

Species: Mus musculus
Genetic Insert: Grin1
Vector Backbone Description: Vector Backbone:gRNA backbone; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760
Comments:

Proper citation: RRID:Addgene_169789 Copy   


  • RRID:Addgene_169786

http://www.addgene.org/169786

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32190101
Comments:

Proper citation: RRID:Addgene_169786 Copy   


  • RRID:Addgene_16985

http://www.addgene.org/16985

Species: Xenopus laevis
Genetic Insert: Xwnt-5A
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pSP64T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8275867
Comments: Insert: cDNA from Melton lambda gt10 oocyte library. Transcription: linearize with Xba1 and transcribe with SP6. Plasmid History: Constructed by Randall Moon on date of 9/15/90. Notes for Use: EcoR1 insert of lambda G6 of 2/11/90. Contains significant 5' UTR and is less translatable in vitro per ng RNA than Xwnt-5A Hind III/SP64T. However, the type of activity is the same in both constructs. Citation: Moon et al., Development 119, 97 (1993)

Proper citation: RRID:Addgene_16985 Copy   


  • RRID:Addgene_16984

http://www.addgene.org/16984

Species: Xenopus laevis
Genetic Insert: banded hedgehog
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:
Comments: Xenopus Hedgehog. Antisense are generated as listed: Xenopus banded hedgehog: Linearize clone XIL in Bluescript KS with BamH1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert. Xenopus sonic hedgehog: Linearize clone X32 in Bluescript KS with Bam H1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert. Xenopus cephalic hedgehog:Linearize clone X30 in pT7TS with Sal 1 and transcribe with T7.

Proper citation: RRID:Addgene_16984 Copy   


  • RRID:Addgene_169781

http://www.addgene.org/169781

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32190101
Comments:

Proper citation: RRID:Addgene_169781 Copy   


  • RRID:Addgene_169782

http://www.addgene.org/169782

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32190101
Comments:

Proper citation: RRID:Addgene_169782 Copy   


  • RRID:Addgene_169780

http://www.addgene.org/169780

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32190101
Comments:

Proper citation: RRID:Addgene_169780 Copy   


  • RRID:Addgene_169779

http://www.addgene.org/169779

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32190101
Comments:

Proper citation: RRID:Addgene_169779 Copy   


  • RRID:Addgene_169814

http://www.addgene.org/169814

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:p15A; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34086276
Comments:

Proper citation: RRID:Addgene_169814 Copy   


  • RRID:Addgene_169897

http://www.addgene.org/169897

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4663; Vector Backbone:pEPIC1.1; Vector Types:Mammalian Expression, Avian expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32917762
Comments:

Proper citation: RRID:Addgene_169897 Copy   


  • RRID:Addgene_169898

http://www.addgene.org/169898

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:2427; Vector Backbone:pPID2; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32917762
Comments:

Proper citation: RRID:Addgene_169898 Copy   


  • RRID:Addgene_169891

    This resource has 1+ mentions.

http://www.addgene.org/169891

Species: Homo sapiens
Genetic Insert: UDP-N-acetylhexosamine pyrophosphorylase
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSin4 EF1a IRES Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34288588
Comments: This plasmid was generated in the lab a long time ago and we cannot locate detailed cloning information at this point.

Proper citation: RRID:Addgene_169891 Copy   


http://www.addgene.org/169892

Species: Synthetic
Genetic Insert: sgRNA targeting ACO1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: CCACTACCCCAACCTGGCGG

Proper citation: RRID:Addgene_169892 Copy   


http://www.addgene.org/16992

Species: Homo sapiens
Genetic Insert: Vangl2/Strabismus
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2P+; Vector Types:Xenopus Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:
Comments: This is a wild type human VANGL2/Strabismuus, cloned into pCS2P+. Injected RNA in zebrafish embryos gives the expected convergent/extension phenotype (Chris Thorpe, unpub. observations). Reference: Made by Yan Zhang by PCR for RTM. Cloned as a Cla1-Xho1 insert.

Proper citation: RRID:Addgene_16992 Copy   


http://www.addgene.org/169894

Species: Synthetic
Genetic Insert: sgRNA targeting IREB2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: AATGCACCAAATCCTGGAGG

Proper citation: RRID:Addgene_169894 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X