Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pMTS-hFluc Resource Report Resource Website |
RRID:Addgene_177716 | hFluc | Other | Ampicillin | PMID:34857875 | Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:10 | 0 | ||
|
pPLN-hFluc-WT-KDEL Resource Report Resource Website |
RRID:Addgene_177715 | hFluc | Other | Ampicillin | PMID:34857875 | Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:10 | 0 | ||
|
pATZ-Myc Resource Report Resource Website |
RRID:Addgene_177718 | alpha-1-antitrypsin | Homo sapiens | Ampicillin | PMID:34857875 | Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin | E342K (ATZ mutant) | 2026-08-01 01:09:10 | 0 | |
|
pAT-WT-HA-GFP11 Resource Report Resource Website |
RRID:Addgene_177719 | alpha-1-antitrypsin | Homo sapiens | Ampicillin | PMID:34857875 | Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:10 | 0 | ||
|
pAAV-nEF-Con/Foff DREADD Gi-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_177673 | DREADD Gi-mCherry | Synthetic | Ampicillin | Backbone Marker:Stratagene; Backbone Size:4591; Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, INTRSECT; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:09 | 1 | |||
|
Grin1 gRNA#1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_169789 | Grin1 | Mus musculus | Ampicillin | PMID:34161760 | Vector Backbone:gRNA backbone; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:57 | 1 | ||
|
pGRNA5e Resource Report Resource Website |
RRID:Addgene_169786 | Kanamycin | PMID:32190101 | Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin | 2026-08-01 01:07:57 | 0 | ||||
|
XP17 Xwnt-5A Resource Report Resource Website |
RRID:Addgene_16985 | Xwnt-5A | Xenopus laevis | Ampicillin | PMID:8275867 | Insert: cDNA from Melton lambda gt10 oocyte library. Transcription: linearize with Xba1 and transcribe with SP6. Plasmid History: Constructed by Randall Moon on date of 9/15/90. Notes for Use: EcoR1 insert of lambda G6 of 2/11/90. Contains significant 5' UTR and is less translatable in vitro per ng RNA than Xwnt-5A Hind III/SP64T. However, the type of activity is the same in both constructs. Citation: Moon et al., Development 119, 97 (1993) | Backbone Size:3000; Vector Backbone:pSP64T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:57 | 0 | |
|
XP6 Banded hh Resource Report Resource Website |
RRID:Addgene_16984 | banded hedgehog | Xenopus laevis | Ampicillin | Xenopus Hedgehog. Antisense are generated as listed: Xenopus banded hedgehog: Linearize clone XIL in Bluescript KS with BamH1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert. Xenopus sonic hedgehog: Linearize clone X32 in Bluescript KS with Bam H1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert. Xenopus cephalic hedgehog:Linearize clone X30 in pT7TS with Sal 1 and transcribe with T7. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:57 | 0 | ||
|
pGRNA4 Resource Report Resource Website |
RRID:Addgene_169781 | Kanamycin | PMID:32190101 | Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin | 2026-08-01 01:07:57 | 0 | ||||
|
pGRNA2e Resource Report Resource Website |
RRID:Addgene_169782 | Kanamycin | PMID:32190101 | Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin | 2026-08-01 01:07:57 | 0 | ||||
|
pGRNA3 Resource Report Resource Website |
RRID:Addgene_169780 | Kanamycin | PMID:32190101 | Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin | 2026-08-01 01:07:57 | 0 | ||||
|
pGRNA2 Resource Report Resource Website |
RRID:Addgene_169779 | Kanamycin | PMID:32190101 | Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin | 2026-08-01 01:07:57 | 0 | ||||
|
p15LZ Resource Report Resource Website |
RRID:Addgene_169814 | Chloramphenicol | PMID:34086276 | Vector Backbone:p15A; Vector Types:; Bacterial Resistance:Chloramphenicol | 2026-08-01 01:07:57 | 0 | ||||
|
pEPIC1.1 Resource Report Resource Website |
RRID:Addgene_169897 | Ampicillin | PMID:32917762 | Backbone Size:4663; Vector Backbone:pEPIC1.1; Vector Types:Mammalian Expression, Avian expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:57 | 0 | ||||
|
pPID2 Resource Report Resource Website |
RRID:Addgene_169898 | Ampicillin | PMID:32917762 | Backbone Size:2427; Vector Backbone:pPID2; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:57 | 0 | ||||
|
pSin4 UAP1 F383G Resource Report Resource Website 1+ mentions |
RRID:Addgene_169891 | UDP-N-acetylhexosamine pyrophosphorylase | Homo sapiens | Ampicillin | PMID:34288588 | This plasmid was generated in the lab a long time ago and we cannot locate detailed cloning information at this point. | Backbone Size:7500; Vector Backbone:pSin4 EF1a IRES Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Changed Phenylalanine (F) at position 383 to glycine (G) | 2026-08-01 01:07:57 | 1 |
|
pLentiCRISPR V2 sgACO1_2 Resource Report Resource Website |
RRID:Addgene_169892 | sgRNA targeting ACO1 | Synthetic | Ampicillin | PMID:34039609 | Target: CCACTACCCCAACCTGGCGG | Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:57 | 0 | |
|
XE238 hVangl2/Strabismus pCS2P+ Resource Report Resource Website 1+ mentions |
RRID:Addgene_16992 | Vangl2/Strabismus | Homo sapiens | Ampicillin | This is a wild type human VANGL2/Strabismuus, cloned into pCS2P+. Injected RNA in zebrafish embryos gives the expected convergent/extension phenotype (Chris Thorpe, unpub. observations). Reference: Made by Yan Zhang by PCR for RTM. Cloned as a Cla1-Xho1 insert. | Backbone Size:4100; Vector Backbone:pCS2P+; Vector Types:Xenopus Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:58 | 1 | ||
|
pLentiCRISPR V2 sgIREB2_1 Resource Report Resource Website |
RRID:Addgene_169894 | sgRNA targeting IREB2 | Synthetic | Ampicillin | PMID:34039609 | Target: AATGCACCAAATCCTGGAGG | Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 01:07:57 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.