Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 131 showing 2601 ~ 2620 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_31917

http://www.addgene.org/31917

Genetic Insert: Medium-FT
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4074; Vector Backbone:pBAD/His-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19136976

Proper citation: RRID:Addgene_31917 Copy   


  • RRID:Addgene_31916

http://www.addgene.org/31916

Genetic Insert: Fast-FT
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4074; Vector Backbone:pBAD/His-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19136976

Proper citation: RRID:Addgene_31916 Copy   


  • RRID:Addgene_31911

    This resource has 1+ mentions.

http://www.addgene.org/31911

Genetic Insert: Medium-FT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4012; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19136976

Proper citation: RRID:Addgene_31911 Copy   


  • RRID:Addgene_31877

    This resource has 1+ mentions.

http://www.addgene.org/31877

Species: Homo sapiens
Genetic Insert: myelin transcription factor 1-like
Vector Backbone Description: Backbone Marker:home made/Crabtree lab; Backbone Size:7998; Vector Backbone:pTight-N174; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21753754

Proper citation: RRID:Addgene_31877 Copy   


  • RRID:Addgene_31910

    This resource has 1+ mentions.

http://www.addgene.org/31910

Genetic Insert: Fast-FT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4012; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19136976

Proper citation: RRID:Addgene_31910 Copy   


  • RRID:Addgene_31913

    This resource has 1+ mentions.

http://www.addgene.org/31913

Genetic Insert: Fast-FT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3125; Vector Backbone:pTRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19136976

Proper citation: RRID:Addgene_31913 Copy   


  • RRID:Addgene_31879

    This resource has 1+ mentions.

http://www.addgene.org/31879

Species: Homo sapiens
Genetic Insert: human cytochrome C oxidase subunit VIII
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4646; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31879 Copy   


  • RRID:Addgene_31912

    This resource has 1+ mentions.

http://www.addgene.org/31912

Genetic Insert: Slow-FT
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19136976

Proper citation: RRID:Addgene_31912 Copy   


  • RRID:Addgene_31915

http://www.addgene.org/31915

Genetic Insert: Slow-FT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3125; Vector Backbone:pTRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19136976

Proper citation: RRID:Addgene_31915 Copy   


  • RRID:Addgene_31981

    This resource has 1+ mentions.

http://www.addgene.org/31981

Species: Homo sapiens
Genetic Insert: LOVS1K
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pTriEx 3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21802009
Comments: Cloning primers: 5' end: CATGCCATGGGGACTAGTTTGGCTACTACACTTGAACGTATTGA 3' end: CTAGCTAGCCAGTGAGTGGATGCCAGGGTTG LOVS1K should be co-expressed with Orai1, such as Orai1 CFP (http://www.addgene.org/19757) or Orai1 YFP (http://www.addgene.org/19756/) deposited by Anjana Rao.

Proper citation: RRID:Addgene_31981 Copy   


  • RRID:Addgene_31984

    This resource has 1+ mentions.

http://www.addgene.org/31984

Species: Homo sapiens
Genetic Insert: Cul5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5070; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18187417

Proper citation: RRID:Addgene_31984 Copy   


  • RRID:Addgene_31983

http://www.addgene.org/31983

Species: Rattus norvegicus
Genetic Insert: Elongin B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5070; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18187417

Proper citation: RRID:Addgene_31983 Copy   


http://www.addgene.org/31906

Genetic Insert: alpha-actinin LSS-mKate1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31906 Copy   


  • RRID:Addgene_31908

http://www.addgene.org/31908

Genetic Insert: LSSmKate1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3999; Vector Backbone:pBAD/His-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31908 Copy   


  • RRID:Addgene_31907

    This resource has 10+ mentions.

http://www.addgene.org/31907

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmcherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:20169111
Comments: Please note: the orientation of the MCS within this plasmid places mCherry on the c-terminus of your gene of interest.

Proper citation: RRID:Addgene_31907 Copy   


  • RRID:Addgene_31909

http://www.addgene.org/31909

Genetic Insert: LSSmKate2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3999; Vector Backbone:pBAD/His-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31909 Copy   


  • RRID:Addgene_31986

    This resource has 10+ mentions.

http://www.addgene.org/31986

Species: Homo sapiens
Genetic Insert: ATM kd
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9733515
Comments: Do not send out as a spot on paper, send out in liquid form.

Proper citation: RRID:Addgene_31986 Copy   


  • RRID:Addgene_31985

    This resource has 10+ mentions.

http://www.addgene.org/31985

Species: Homo sapiens
Genetic Insert: ATM wild-type
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9733515

Proper citation: RRID:Addgene_31985 Copy   


  • RRID:Addgene_31902

    This resource has 1+ mentions.

http://www.addgene.org/31902

Genetic Insert: alpha-tubulin
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31902 Copy   


  • RRID:Addgene_31901

http://www.addgene.org/31901

Species: Drosophila melanogaster
Genetic Insert: TAF4
Vector Backbone Description: Vector Backbone:pMA6; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19116271
Comments: Previously used in Drosophila, not tested in Sf9 cells.

Proper citation: RRID:Addgene_31901 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X