Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

739,854 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
paGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_18697 photoactivatable GFP Ampicillin PMID:18556515 Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin A206K mutation 2026-08-08 01:13:45 6
GLUT9-eGFP/pcDNA-DEST47
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_18730 GLUT9-eGFP/pcDNA-DEST47 Homo sapiens Ampicillin PMID:18177733 Backbone Size:7780; Vector Backbone:pcDNA-DEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted TAA 2026-08-08 01:13:45 3
pNL-EGFP/EF1alpha/WPREdU3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_18698 EGFP Aequorea victoria Ampicillin PMID:18513160 Backbone Size:9137; Vector Backbone:pUC18; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-08 01:13:45 1
pCMV mouse sidekick2
 
Resource Report
Resource Website
RRID:Addgene_18735 Sidekick-2 Mus musculus Kanamycin PMID:18216854 The NdeI-NotI fragment obtained from mKIAA1514 plasmid was cloned into the XhoI and NotI sites of EGFP-N1, and the XhoI-NdeI fragment was replaced by a cDNA amplified with primers GGCCCTCGAGTTATAAAGCAACTCGCAAAGAGG and CTGTTGTAGGCAGCCACCTCGATC. Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-08 01:13:45 0
pCMV mouse Dscam
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_18737 Dscam Mus musculus Kanamycin PMID:18216854 An AccI-NotI fragment from IMAGE clone 6410759 (ATCC) was cloned into the SalI/NotI sites of EGFP-N1. The AccI-AccI fragment was then replaced with cDNA amplified from mouse brain using primers GGCCGTCGACGTGGCTCGCTCGCTGGCTCGCTGGCT and CGACTCCAGCCGAGTTGTTGGCAGT. Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-08 01:13:45 1
pFA6a-PA-GFP-TRP1
 
Resource Report
Resource Website
RRID:Addgene_18821 Photoactivatable Green Fluorescent Protein Aequorea victoria Ampicillin PMID:18727145 U.S. Tulu, et al. (2003). "Peripheral, Non-Centrosome-Associated Microtubules Contribute to Spindle Formation in Centrosome-Containing Cells" Curr Biol 13: 1894-99. Backbone Size:3421; Vector Backbone:pFA6a-TRP1; Vector Types:Yeast tagging; Bacterial Resistance:Ampicillin 2026-08-08 01:13:46 0
TRPML1-MYC
 
Resource Report
Resource Website
RRID:Addgene_18824 TRPML1 Homo sapiens Ampicillin PMID:16606612 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-08 01:13:46 0
TRPML1-HA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_18825 TRPML1 Homo sapiens Ampicillin PMID:16606612 Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-08 01:13:46 3
TRPML2-YFP
 
Resource Report
Resource Website
RRID:Addgene_18830 TRPML2 Mus musculus Ampicillin PMID:16606612 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-08 01:13:46 0
TRPML2-CFP
 
Resource Report
Resource Website
RRID:Addgene_18831 TRPML2 Mus musculus Ampicillin PMID:16606612 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-08 01:13:46 0
TRPML3-HA
 
Resource Report
Resource Website
RRID:Addgene_18832 TRPML3 Mus musculus Ampicillin PMID:16606612 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-08 01:13:46 0
TRPML3-CFP
 
Resource Report
Resource Website
RRID:Addgene_18834 TRPML3 Mus musculus Ampicillin PMID:16606612 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Q165R, F210Y 2026-08-08 01:13:46 0
pcDNA3-AKT-PH-GFP
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_18836 AKT-PH domain Homo sapiens Ampicillin PMID:17317623 Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contains amino acids 1-148 (compared to GenBank reference NP_005154.2) 2026-08-08 01:13:46 29
pcDNA3-AKT-PH[R25C]-GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_18837 AKT-PH domain Homo sapiens Ampicillin PMID:17317623 Backbone Size:5000; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R25C 2026-08-08 01:13:46 3
SV40 basal promoter-GFP-IRES-AP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_18807 SV40 basal promoter-GFP-IRES-AP Ampicillin PMID:18667607 also known as gl3promoter gfp ires ap, Kim, D.S., Matsuda, T., and Cepko, C.L. (2008) A core paired-type and POU homeodomain-containing transcription factor program drives retinal bipolar cell gene expression. J. Neurosci. In press. Backbone Size:0; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-08 01:13:46 2
SV40 basal promoter-tdTomato-IRES-AP
 
Resource Report
Resource Website
RRID:Addgene_18809 SV40 basal promoter-tdTomato-IRES-AP Ampicillin PMID:18667607 also known as gtia1, Kim, D.S., Matsuda, T., and Cepko, C.L. (2008) A core paired-type and POU homeodomain-containing transcription factor program drives retinal bipolar cell gene expression. J. Neurosci. In press. Backbone Size:0; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-08 01:13:46 0
pPro24-gfp
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_18880 GFPuv A. victoria Ampicillin PMID:16269719 Backbone Size:5064; Vector Backbone:pPro24; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-08 01:13:46 1
pcDNA Flag Yap1 Y357F
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_18882 Yap1 Y357F Homo sapiens Ampicillin PMID:18280240 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Y357F 2026-08-08 01:13:46 2
pcDNA Flag Yap1 Y357E
 
Resource Report
Resource Website
RRID:Addgene_18883 Yap1 Y357E Homo sapiens Ampicillin PMID:18280240 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Y357E 2026-08-08 01:13:46 0
pYBS370
 
Resource Report
Resource Website
RRID:Addgene_18886 Ste7 Saccharomyces cerevisiae Ampicillin PMID:8062390 Lex-Ste7C has the 1 kb BglII-BamHI fragment of pYEE129 at BamHI of pYBS311 Backbone Size:11000; Vector Backbone:pYBS311; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin kinase domain of C-terminal 344 residues 2026-08-08 01:13:46 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.