Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: photoactivatable GFP
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18556515
Proper citation: RRID:Addgene_18697 Copy
Species: Homo sapiens
Genetic Insert: GLUT9-eGFP/pcDNA-DEST47
Vector Backbone Description: Backbone Size:7780; Vector Backbone:pcDNA-DEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18177733
Proper citation: RRID:Addgene_18730 Copy
Species: Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:9137; Vector Backbone:pUC18; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18513160
Proper citation: RRID:Addgene_18698 Copy
Species: Mus musculus
Genetic Insert: Sidekick-2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18216854
Comments: The NdeI-NotI fragment obtained from mKIAA1514 plasmid was cloned into the XhoI and NotI sites of EGFP-N1, and the XhoI-NdeI fragment was replaced by a cDNA amplified with primers GGCCCTCGAGTTATAAAGCAACTCGCAAAGAGG and CTGTTGTAGGCAGCCACCTCGATC.
Proper citation: RRID:Addgene_18735 Copy
Species: Mus musculus
Genetic Insert: Dscam
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18216854
Comments: An AccI-NotI fragment from IMAGE clone 6410759 (ATCC) was cloned into the SalI/NotI sites of EGFP-N1. The AccI-AccI fragment was then replaced with cDNA amplified from mouse brain using primers GGCCGTCGACGTGGCTCGCTCGCTGGCTCGCTGGCT and CGACTCCAGCCGAGTTGTTGGCAGT.
Proper citation: RRID:Addgene_18737 Copy
Species: Aequorea victoria
Genetic Insert: Photoactivatable Green Fluorescent Protein
Vector Backbone Description: Backbone Size:3421; Vector Backbone:pFA6a-TRP1; Vector Types:Yeast tagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18727145
Comments: U.S. Tulu, et al. (2003). "Peripheral, Non-Centrosome-Associated Microtubules Contribute to Spindle Formation in Centrosome-Containing Cells" Curr Biol 13: 1894-99.
Proper citation: RRID:Addgene_18821 Copy
Species: Homo sapiens
Genetic Insert: TRPML1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18824 Copy
Species: Homo sapiens
Genetic Insert: TRPML1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18825 Copy
Species: Mus musculus
Genetic Insert: TRPML2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18830 Copy
Species: Mus musculus
Genetic Insert: TRPML2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18831 Copy
Species: Mus musculus
Genetic Insert: TRPML3
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18832 Copy
Species: Mus musculus
Genetic Insert: TRPML3
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612
Proper citation: RRID:Addgene_18834 Copy
Species: Homo sapiens
Genetic Insert: AKT-PH domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17317623
Proper citation: RRID:Addgene_18836 Copy
Species: Homo sapiens
Genetic Insert: AKT-PH domain
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17317623
Proper citation: RRID:Addgene_18837 Copy
Genetic Insert: SV40 basal promoter-GFP-IRES-AP
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18667607
Comments: also known as gl3promoter gfp ires ap, Kim, D.S., Matsuda, T., and Cepko, C.L. (2008) A core paired-type and POU homeodomain-containing transcription factor program drives retinal bipolar cell gene expression. J. Neurosci. In press.
Proper citation: RRID:Addgene_18807 Copy
Genetic Insert: SV40 basal promoter-tdTomato-IRES-AP
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18667607
Comments: also known as gtia1, Kim, D.S., Matsuda, T., and Cepko, C.L. (2008) A core paired-type and POU homeodomain-containing transcription factor program drives retinal bipolar cell gene expression. J. Neurosci. In press.
Proper citation: RRID:Addgene_18809 Copy
Species: A. victoria
Genetic Insert: GFPuv
Vector Backbone Description: Backbone Size:5064; Vector Backbone:pPro24; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16269719
Proper citation: RRID:Addgene_18880 Copy
Species: Homo sapiens
Genetic Insert: Yap1 Y357F
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18280240
Proper citation: RRID:Addgene_18882 Copy
Species: Homo sapiens
Genetic Insert: Yap1 Y357E
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18280240
Proper citation: RRID:Addgene_18883 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ste7
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pYBS311; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8062390
Comments: Lex-Ste7C has the 1 kb BglII-BamHI fragment of pYEE129 at BamHI of pYBS311
Proper citation: RRID:Addgene_18886 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.