Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:danio rerio (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,206 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pminiTol2-4kb wnt3 promoter-Wnt3EGFP
 
Resource Report
Resource Website 		RRID:Addgene_203793 Wnt3 Danio rerio Ampicillin PMID:26395493 Backbone Size:3565; Vector Backbone:pminiTol2; Vector Types:Zebrafish Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:39:22 0
pCRII HSPB7
 
Resource Report
Resource Website 		RRID:Addgene_61034 HSPB7 Danio rerio Ampicillin PMID:18161059 linearize with NotI, transcribe with SP6, probe length is 519. Note: Addgene's quality control sequencing has found a few mismatches in the plasmid insert, but they should not affect its ability to be used as a probe. Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:29:43 0
Zf Slit1b
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61280 Slit1b Danio rerio Ampicillin PMID:14579375 antisense probe: cut with SmaI and use T7. Backbone Marker:Stratagene; Vector Backbone:pBSII SK(+); Vector Types:cloning vector; Bacterial Resistance:Ampicillin 2026-09-12 02:29:45 1
pBS-Isce1-eno2:egfp
 
Resource Report
Resource Website 		RRID:Addgene_61394 eno2 regulatory element Danio rerio Ampicillin PMID:17897967 Vector Backbone:pBS; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin 2026-09-12 02:29:46 0
pCK074 p5E exorh:EGFP
 
Resource Report
Resource Website 		RRID:Addgene_195951 exorh:EGFP Danio rerio Kanamycin PMID:36975217 Please visit https://doi.org/10.1101/2022.12.13.520107 for bioRxiv preprint. Vector Backbone:pENTR5'; Vector Types:Other; Bacterial Resistance:Kanamycin 2026-09-12 02:36:44 0
pTRIP-SFFV-mtagBFP-2A-ZebrafishSTING
 
Resource Report
Resource Website 		RRID:Addgene_196633 ZebrafishSTING Danio rerio Ampicillin PMID:36820829 Vector Backbone:pTRIP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin WT 2026-09-12 02:36:45 0
p3E ubb polyA
 
Resource Report
Resource Website 		RRID:Addgene_195977 ubb:polyA Danio rerio Kanamycin PMID:36975217 Please visit https://doi.org/10.1101/2022.12.13.520107 for bioRxiv preprint. Vector Backbone:p3E; Vector Types:Other; Bacterial Resistance:Kanamycin 2026-09-12 02:36:45 0
pDONR221-si:ch73-1a9.3
 
Resource Report
Resource Website 		RRID:Addgene_192717 si:ch73-1a9.3 Danio rerio Kanamycin cDNA encodes NP_001373649.1; homolog of human HMGN1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-09-12 02:35:57 0
pDONR221-si:ch73-281n10.2
 
Resource Report
Resource Website 		RRID:Addgene_192716 si:ch73-281n10.2 Danio rerio Kanamycin cDNA encodes NP_001296573.1; homolog of human HMGN1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-09-12 02:35:57 0
pDONR221-ets2
 
Resource Report
Resource Website 		RRID:Addgene_192724 ets2 Danio rerio Kanamycin cDNA encodes NP_001018874.1; homolog of human ETS2 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin N189D (rs502796915); S231N 2026-09-12 02:35:57 0
pDONR221-get1
 
Resource Report
Resource Website 		RRID:Addgene_192722 get1 Danio rerio Kanamycin cDNA encodes NP_001003413.1; homolog of human GET1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-09-12 02:35:57 0
pDONR221-kcnj6
 
Resource Report
Resource Website 		RRID:Addgene_192725 kcnj6 Danio rerio Kanamycin cDNA encodes homolog of human KCNJ6 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 5' insertion of ATGGCCAAGCTGACAGAATCC, identical to human KCNJ6 2026-09-12 02:35:57 0
pDONR221-appa
 
Resource Report
Resource Website 		RRID:Addgene_192745 appa Danio rerio Kanamycin cDNA encodes AFN73054.1; homolog of human APP Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin S47N 2026-09-12 02:35:59 0
pTwist-ENTR-rbm11-202
 
Resource Report
Resource Website 		RRID:Addgene_192729 rbm11 Danio rerio Kanamycin cDNA encodes rbm11-202; homolog of human RBM11 Backbone Marker:Twist Bioscience; Vector Backbone:pTwist ENTR Kozak; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-09-12 02:35:59 0
pDONR221-nrip1a
 
Resource Report
Resource Website 		RRID:Addgene_192731 nrip1a Danio rerio Kanamycin cDNA encodes XP_005157806.1; homolog of human NRIP1 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin E662Q; S895P; H967Q 2026-09-12 02:35:59 0
pDONR221-btg3
 
Resource Report
Resource Website 		RRID:Addgene_192735 btg3 Danio rerio Kanamycin cDNA encodes NP_001313635.1; homolog of human BTG3 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin H211Y 2026-09-12 02:35:59 0
pDONR221-cxadr
 
Resource Report
Resource Website 		RRID:Addgene_192734 cxadr Danio rerio Kanamycin cDNA encodes NP_694480.1; homolog of human CXADR Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-09-12 02:35:59 0
pDONR221-ncam2
 
Resource Report
Resource Website 		RRID:Addgene_192739 ncam2 Danio rerio Kanamycin cDNA encodes NP_571905.1; homolog of human NCAM2 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-09-12 02:35:59 0
pDONR221-chodl
 
Resource Report
Resource Website 		RRID:Addgene_192738 chodl Danio rerio Kanamycin cDNA encodes NP_001017578.1; homolog of human CHODL Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin S192I 2026-09-12 02:35:59 0
pDONR221-si:dkey-79d12.5
 
Resource Report
Resource Website 		RRID:Addgene_192736 si:dkey-79d12.5 Danio rerio Kanamycin cDNA encodes XP_003200235.2; homolog of human BTG3 Backbone Marker:Invitrogen; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin F81L (rs502894743); D168N; S186A (rs503020532) 2026-09-12 02:35:59 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

NIDDK Early Research Partnership Engagement Challenge

Funding Opportunity: National NIH K12 DiabDocs Career Development Program

NIH Data Sharing and Reuse Seminar- Sex Differences in Acute Kidney Injury Risk and Outcomes: Insights from MIMIC-III and MIMIC-IV

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch