Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: miR-106a-363
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21454525
Comments: miR-106a-363 micro RNA sequence - caaagtgctaacagtgcaggtag
Proper citation: RRID:Addgene_31703 Copy
Species: Mus musculus
Genetic Insert: miR-18b
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21454525
Proper citation: RRID:Addgene_31706 Copy
Species: Homo sapiens
Genetic Insert: protein kinase, AMP-activated, alpha 2 catalytic subunit
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581
Proper citation: RRID:Addgene_31652 Copy
Species: Oryctolagus cuniculus
Genetic Insert: solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1/Hygro (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14580213
Comments: ERRATUM- Materials & Methods :This in NOT the mouse NHERF-1 cDNA.Paper should read "The rabbit cDNA was inserted into......".
The rabbit cDNA was cut from the pet30a vector & put into pcDNA. The his & S tag comes from the pet30a vector.
VECTOR UPDATED JAN14,2002
his tagged rabbit NHERF PDZ1 mutation PNGYGF to HNGAGA
pcDNA3.1/hygr(+) cut nhe1&xho1
pET 30ac_FMZ1.seq cut Xba1 & Xho1
his tag translation = 937
Proper citation: RRID:Addgene_31651 Copy
Species: Homo sapiens
Genetic Insert: protein kinase, AMP-activated, alpha 2 catalytic subunit
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581
Proper citation: RRID:Addgene_31654 Copy
Species: Homo sapiens
Genetic Insert: BAI1-associated protein 2 S366A
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581
Proper citation: RRID:Addgene_31657 Copy
Species: Homo sapiens
Genetic Insert: Protein Phosphatase 1 Regulatory Subunit 12C
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581
Proper citation: RRID:Addgene_31659 Copy
Species: Homo sapiens
Genetic Insert: Trask
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5151; Vector Backbone:pcDNA4-TO-myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21559459
Proper citation: RRID:Addgene_31768 Copy
Species: Homo sapiens
Genetic Insert: GRM3
Vector Backbone Description: Backbone Marker:SBI; Backbone Size:6600; Vector Backbone:pCDF1- MCS2-EF1-puromycin; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21946352
Proper citation: RRID:Addgene_31801 Copy
Species: Homo sapiens
Genetic Insert: Rab8a
Vector Backbone Description: Vector Backbone:P643_pmEGFP_N_dest.; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21310966
Proper citation: RRID:Addgene_31803 Copy
Species: Homo sapiens
Genetic Insert: Trask
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5151; Vector Backbone:pcDNA4-TO-myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21559459
Proper citation: RRID:Addgene_31769 Copy
Species: Homo sapiens
Genetic Insert: GRM3
Vector Backbone Description: Backbone Marker:SBI; Backbone Size:6600; Vector Backbone:pCDF1- MCS2-EF1-puromycin; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21946352
Proper citation: RRID:Addgene_31802 Copy
Species: Homo sapiens
Genetic Insert: pGALT
Vector Backbone Description: Vector Backbone:EGFP_IRES_puro2b; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21310966
Comments: * Note that Addgene found a D76E point mutation in the insert during quality control sequencing. This mutation did not affect the original function of this construct (visualizing the Golgi structure), but if you plan on using the construct for something else, please take the mutation into account.
Proper citation: RRID:Addgene_31804 Copy
Species: Drosophila melanogaster
Genetic Insert: Khc73
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pMTWG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The construct contains an L466P mutation in Khc73 relative to GenBank reference sequences.
Proper citation: RRID:Addgene_31750 Copy
Species: Mus musculus
Genetic Insert: NLS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4678; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155
Proper citation: RRID:Addgene_31871 Copy
Genetic Insert: NLS-LSS-mKate1
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20212155
Proper citation: RRID:Addgene_31873 Copy
Species: Drosophila melanogaster
Genetic Insert: Patronin
Vector Backbone Description: Backbone Size:4200; Vector Backbone:pMT-GFP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20946984
Proper citation: RRID:Addgene_31754 Copy
Species: Drosophila melanogaster
Genetic Insert: Patronin
Vector Backbone Description: Backbone Size:4200; Vector Backbone:pMT-GFP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20946984
Proper citation: RRID:Addgene_31757 Copy
Genetic Insert: PP7delFG Coat Protein
Vector Backbone Description: Vector Backbone:pET22; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18066080
Proper citation: RRID:Addgene_31863 Copy
Genetic Insert: 24xPP7 Stem Loop Cassette
Vector Backbone Description: Vector Backbone:pCR4blunt; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21512033
Comments: The 24xPP7 stem loop cassettes in this plasmid were generated from two non-identical stem-loops to reduce unnecessary redundancy and the chance of recombination in bacteria. The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is:
taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt
Proper citation: RRID:Addgene_31864 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
