Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pTRETightBI-RY-4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31465 | eYFP and mCherry | fluorescent proteins | Ampicillin | PMID:21857679 | 4 tandem miR-20 binding sites in mCherry 3'UTR | Backbone Marker:Clontech; Backbone Size:2850; Vector Backbone:pTRETightBI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 2 | |
|
pQTEV-COPE Resource Report Resource Website |
RRID:Addgene_31585 | coatomer protein complex, subunit epsilon | Homo sapiens | Ampicillin | PMID:15998469 | The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence. | Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:01 | 0 | |
|
pSLIK sh human Rb 1534 hyg Resource Report Resource Website 1+ mentions |
RRID:Addgene_31500 | RB shRNA | Homo sapiens | Ampicillin | The whole sequence for the shRNA including the loop should be from 3872-3931 in the vector: AGCGAAACGATTATCCATTCAAATAGTGAAGCCACAGATGTATTTGAAT The shRNA is downstream of the EGFP GGATAATCGTT pSLIK vector from Ian Frasier | Backbone Size:13700; Vector Backbone:pSLIK-EGFP; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | The target sequence for shRB 1534 is GAACGATTATCCATTCAAA | 2026-09-19 02:17:00 | 3 | |
|
pTRETightBI-RY-7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31466 | eYFP and mCherry | fluorescent proteins | Ampicillin | PMID:21857679 | 7 tandem miR-20 binding sites in mCherry 3'UTR | Backbone Marker:Clontech; Backbone Size:2850; Vector Backbone:pTRETightBI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 1 | |
|
pQStrep2-ARPC3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31580 | Actin related protein 2/3 complex, subunit 3 | Homo sapiens | Ampicillin | PMID:15998469 | The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. Please note that Addgene's quality control sequence shows a small deletion in the vector region downstream of insert; the deletion does not affect any features in this construct. | Backbone Size:3460; Vector Backbone:pQStrep2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 1 | |
|
MDH1-miR-196a-1-PGK-GFP-Blast Resource Report Resource Website |
RRID:Addgene_31509 | miR-196a1 | Mus musculus | Ampicillin | PMID:21451113 | Backbone Size:0; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | ||
|
pTRETightBI-RY-HMGA2wt Resource Report Resource Website |
RRID:Addgene_31469 | eYFP and mCherry | fluorescent proteins | Ampicillin | PMID:21857679 | mCherry reporter fused to murine hmga2 3'UTR, containing seven binding sites for the miRNA family let-7 | Backbone Marker:Clontech; Backbone Size:2850; Vector Backbone:pTRETightBI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | |
|
L4440-daf-16b Resource Report Resource Website |
RRID:Addgene_31504 | daf-16b specific | Caenorhabditis elegans | Ampicillin | PMID:20613724 | Please note that Addgene's sequencing results found two nucleotide mismatches at bp# 450 & 525 when compared to the sequence provided by the depositing scientist. These mismatches are not a concern for the function of the plasmid. | Backbone Size:2790; Vector Backbone:L4440; Vector Types:RNAi; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | |
|
L4440-daf-16af Resource Report Resource Website |
RRID:Addgene_31506 | daf-16a/f common | Caenorhabditis elegans | Ampicillin | PMID:20613724 | Backbone Size:2790; Vector Backbone:L4440; Vector Types:RNAi; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | ||
|
MSCV miRNA control plasmid Resource Report Resource Website |
RRID:Addgene_31508 | Ampicillin | PMID:21451113 | Backbone Size:0; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | ||||
|
pQStrep2-PIR Resource Report Resource Website |
RRID:Addgene_31570 | pirin | Homo sapiens | Ampicillin | PMID:15998469 | Please note that there is a small gap between Addgene's quality control sequence and the reference sequence provided by the depositor. The gap is downstream of the ORF and should not affect function. | Backbone Size:3460; Vector Backbone:pQStrep2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | |
|
pRLCon1-449 Resource Report Resource Website |
RRID:Addgene_31452 | HNF4A 3'UTR fragment | Homo sapiens | Ampicillin | PMID:22140441 | To measure regulatory potential of 3'UTR Please note that there are some small discrepancies between Addgene's quality control sequence and the assembled sequence from the depositor. These discrepancies should not affect the function of the plasmid. | Backbone Size:6380; Vector Backbone:pRL-Con; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-09-19 02:16:59 | 0 | |
|
pRLCon1-249 Resource Report Resource Website |
RRID:Addgene_31453 | HNF4A 3'UTR fragment | Homo sapiens | Ampicillin | PMID:22140441 | To measure regulatory potential of 3'UTR | Backbone Size:6380; Vector Backbone:pRL-Con; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-09-19 02:16:59 | 0 | |
|
pRS316-IVa Resource Report Resource Website |
RRID:Addgene_31456 | linker | Ampicillin | PMID:21722715 | pRS plasmid series originally constructed by Sikorski and Hieter (Sikorski, R.S. and Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122 (1989), pp. 19-27.) | Backbone Marker:Sikorski R., Hieter P.; Backbone Size:4887; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | ||
|
ZM (pyrFEKO-HYG TetR-T7RNAP) Resource Report Resource Website |
RRID:Addgene_31455 | Ampicillin | Backbone Size:6191; Vector Backbone:pyrFEKO; Vector Types:Floxed targeting vector for Trypanosome; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | |||||
|
pRS413-IVa Resource Report Resource Website |
RRID:Addgene_31458 | linker | Ampicillin | PMID:21722715 | pRS plasmid series originally constructed by Sikorski and Hieter (Sikorski, R.S. and Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122 (1989), pp. 19-27.) | Backbone Size:4970; Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | ||
|
pRS316-IVb Resource Report Resource Website |
RRID:Addgene_31457 | linker | Ampicillin | PMID:21722715 | pRS plasmid series originally constructed by Sikorski and Hieter (Sikorski, R.S. and Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122 (1989), pp. 19-27.) | Backbone Size:4887; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | ||
|
pQTEV-PHYHIP Resource Report Resource Website |
RRID:Addgene_31578 | phytanoyl-CoA hydroxylase interacting protein | Homo sapiens | Ampicillin | PMID:15998469 | The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence. | Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | |
|
pRS413-IVb Resource Report Resource Website |
RRID:Addgene_31459 | linker | Ampicillin | PMID:21722715 | pRS plasmid series originally constructed by Sikorski and Hieter (Sikorski, R.S. and Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122 (1989), pp. 19-27.) | Backbone Size:4970; Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 | ||
|
pQTEV-DGCR6 Resource Report Resource Website |
RRID:Addgene_31564 | DiGeorge syndrome critical region gene 6 | Homo sapiens | Ampicillin | PMID:15998469 | The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence. | Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:17:00 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
