Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: fluorescent proteins
Genetic Insert: eYFP and mCherry
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:2850; Vector Backbone:pTRETightBI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21857679
Comments: 4 tandem miR-20 binding sites in mCherry 3'UTR
Proper citation: RRID:Addgene_31465 Copy
Species: Homo sapiens
Genetic Insert: coatomer protein complex, subunit epsilon
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998469
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31585 Copy
Species: Homo sapiens
Genetic Insert: RB shRNA
Vector Backbone Description: Backbone Size:13700; Vector Backbone:pSLIK-EGFP; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: The whole sequence for the shRNA including the loop should be from 3872-3931 in the vector: AGCGAAACGATTATCCATTCAAATAGTGAAGCCACAGATGTATTTGAAT
The shRNA is downstream of the EGFP
GGATAATCGTT
pSLIK vector from Ian Frasier
Proper citation: RRID:Addgene_31500 Copy
Species: fluorescent proteins
Genetic Insert: eYFP and mCherry
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:2850; Vector Backbone:pTRETightBI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21857679
Comments: 7 tandem miR-20 binding sites in mCherry 3'UTR
Proper citation: RRID:Addgene_31466 Copy
Species: Homo sapiens
Genetic Insert: Actin related protein 2/3 complex, subunit 3
Vector Backbone Description: Backbone Size:3460; Vector Backbone:pQStrep2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998469
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
Please note that Addgene's quality control sequence shows a small deletion in the vector region downstream of insert; the deletion does not affect any features in this construct.
Proper citation: RRID:Addgene_31580 Copy
Species: Mus musculus
Genetic Insert: miR-196a1
Vector Backbone Description: Backbone Size:0; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21451113
Proper citation: RRID:Addgene_31509 Copy
Species: fluorescent proteins
Genetic Insert: eYFP and mCherry
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:2850; Vector Backbone:pTRETightBI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21857679
Comments: mCherry reporter fused to murine hmga2 3'UTR, containing seven binding sites for the miRNA family let-7
Proper citation: RRID:Addgene_31469 Copy
Species: Caenorhabditis elegans
Genetic Insert: daf-16b specific
Vector Backbone Description: Backbone Size:2790; Vector Backbone:L4440; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20613724
Comments: Please note that Addgene's sequencing results found two nucleotide mismatches at bp# 450 & 525 when compared to the sequence provided by the depositing scientist. These mismatches are not a concern for the function of the plasmid.
Proper citation: RRID:Addgene_31504 Copy
Species: Caenorhabditis elegans
Genetic Insert: daf-16a/f common
Vector Backbone Description: Backbone Size:2790; Vector Backbone:L4440; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20613724
Proper citation: RRID:Addgene_31506 Copy
Vector Backbone Description: Backbone Size:0; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21451113
Proper citation: RRID:Addgene_31508 Copy
Species: Homo sapiens
Genetic Insert: pirin
Vector Backbone Description: Backbone Size:3460; Vector Backbone:pQStrep2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998469
Comments: Please note that there is a small gap between Addgene's quality control sequence and the reference sequence provided by the depositor. The gap is downstream of the ORF and should not affect function.
Proper citation: RRID:Addgene_31570 Copy
Species: Homo sapiens
Genetic Insert: HNF4A 3'UTR fragment
Vector Backbone Description: Backbone Size:6380; Vector Backbone:pRL-Con; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22140441
Comments: To measure regulatory potential of 3'UTR
Please note that there are some small discrepancies between Addgene's quality control sequence and the assembled sequence from the depositor. These discrepancies should not affect the function of the plasmid.
Proper citation: RRID:Addgene_31452 Copy
Species: Homo sapiens
Genetic Insert: HNF4A 3'UTR fragment
Vector Backbone Description: Backbone Size:6380; Vector Backbone:pRL-Con; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22140441
Comments: To measure regulatory potential of 3'UTR
Proper citation: RRID:Addgene_31453 Copy
Genetic Insert: linker
Vector Backbone Description: Backbone Marker:Sikorski R., Hieter P.; Backbone Size:4887; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21722715
Comments: pRS plasmid series originally constructed by Sikorski and Hieter (Sikorski, R.S. and Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122 (1989), pp. 19-27.)
Proper citation: RRID:Addgene_31456 Copy
Vector Backbone Description: Backbone Size:6191; Vector Backbone:pyrFEKO; Vector Types:Floxed targeting vector for Trypanosome; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_31455 Copy
Genetic Insert: linker
Vector Backbone Description: Backbone Size:4970; Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21722715
Comments: pRS plasmid series originally constructed by Sikorski and Hieter (Sikorski, R.S. and Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122 (1989), pp. 19-27.)
Proper citation: RRID:Addgene_31458 Copy
Genetic Insert: linker
Vector Backbone Description: Backbone Size:4887; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21722715
Comments: pRS plasmid series originally constructed by Sikorski and Hieter (Sikorski, R.S. and Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122 (1989), pp. 19-27.)
Proper citation: RRID:Addgene_31457 Copy
Species: Homo sapiens
Genetic Insert: phytanoyl-CoA hydroxylase interacting protein
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998469
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31578 Copy
Genetic Insert: linker
Vector Backbone Description: Backbone Size:4970; Vector Backbone:pRS413; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21722715
Comments: pRS plasmid series originally constructed by Sikorski and Hieter (Sikorski, R.S. and Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122 (1989), pp. 19-27.)
Proper citation: RRID:Addgene_31459 Copy
Species: Homo sapiens
Genetic Insert: DiGeorge syndrome critical region gene 6
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998469
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31564 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
