SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 122 showing 2421 ~ 2440 out of 743,073 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_18697

    This resource has 1+ mentions.

http://www.addgene.org/18697

Genetic Insert: photoactivatable GFP
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18556515

Proper citation: RRID:Addgene_18697 Copy   


  • RRID:Addgene_18730

    This resource has 1+ mentions.

http://www.addgene.org/18730

Species: Homo sapiens
Genetic Insert: GLUT9-eGFP/pcDNA-DEST47
Vector Backbone Description: Backbone Size:7780; Vector Backbone:pcDNA-DEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18177733

Proper citation: RRID:Addgene_18730 Copy   


  • RRID:Addgene_18698

    This resource has 1+ mentions.

http://www.addgene.org/18698

Species: Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:9137; Vector Backbone:pUC18; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18513160

Proper citation: RRID:Addgene_18698 Copy   


  • RRID:Addgene_18735

http://www.addgene.org/18735

Species: Mus musculus
Genetic Insert: Sidekick-2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18216854
Comments: The NdeI-NotI fragment obtained from mKIAA1514 plasmid was cloned into the XhoI and NotI sites of EGFP-N1, and the XhoI-NdeI fragment was replaced by a cDNA amplified with primers GGCCCTCGAGTTATAAAGCAACTCGCAAAGAGG and CTGTTGTAGGCAGCCACCTCGATC.

Proper citation: RRID:Addgene_18735 Copy   


  • RRID:Addgene_18737

    This resource has 1+ mentions.

http://www.addgene.org/18737

Species: Mus musculus
Genetic Insert: Dscam
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18216854
Comments: An AccI-NotI fragment from IMAGE clone 6410759 (ATCC) was cloned into the SalI/NotI sites of EGFP-N1. The AccI-AccI fragment was then replaced with cDNA amplified from mouse brain using primers GGCCGTCGACGTGGCTCGCTCGCTGGCTCGCTGGCT and CGACTCCAGCCGAGTTGTTGGCAGT.

Proper citation: RRID:Addgene_18737 Copy   


  • RRID:Addgene_18821

http://www.addgene.org/18821

Species: Aequorea victoria
Genetic Insert: Photoactivatable Green Fluorescent Protein
Vector Backbone Description: Backbone Size:3421; Vector Backbone:pFA6a-TRP1; Vector Types:Yeast tagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18727145
Comments: U.S. Tulu, et al. (2003). "Peripheral, Non-Centrosome-Associated Microtubules Contribute to Spindle Formation in Centrosome-Containing Cells" Curr Biol 13: 1894-99.

Proper citation: RRID:Addgene_18821 Copy   


  • RRID:Addgene_18824

http://www.addgene.org/18824

Species: Homo sapiens
Genetic Insert: TRPML1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612

Proper citation: RRID:Addgene_18824 Copy   


  • RRID:Addgene_18825

    This resource has 1+ mentions.

http://www.addgene.org/18825

Species: Homo sapiens
Genetic Insert: TRPML1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612

Proper citation: RRID:Addgene_18825 Copy   


  • RRID:Addgene_18830

http://www.addgene.org/18830

Species: Mus musculus
Genetic Insert: TRPML2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612

Proper citation: RRID:Addgene_18830 Copy   


  • RRID:Addgene_18831

http://www.addgene.org/18831

Species: Mus musculus
Genetic Insert: TRPML2
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612

Proper citation: RRID:Addgene_18831 Copy   


  • RRID:Addgene_18832

http://www.addgene.org/18832

Species: Mus musculus
Genetic Insert: TRPML3
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612

Proper citation: RRID:Addgene_18832 Copy   


  • RRID:Addgene_18834

http://www.addgene.org/18834

Species: Mus musculus
Genetic Insert: TRPML3
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16606612

Proper citation: RRID:Addgene_18834 Copy   


  • RRID:Addgene_18836

    This resource has 10+ mentions.

http://www.addgene.org/18836

Species: Homo sapiens
Genetic Insert: AKT-PH domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17317623

Proper citation: RRID:Addgene_18836 Copy   


  • RRID:Addgene_18837

    This resource has 1+ mentions.

http://www.addgene.org/18837

Species: Homo sapiens
Genetic Insert: AKT-PH domain
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17317623

Proper citation: RRID:Addgene_18837 Copy   


http://www.addgene.org/18807

Genetic Insert: SV40 basal promoter-GFP-IRES-AP
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18667607
Comments: also known as gl3promoter gfp ires ap, Kim, D.S., Matsuda, T., and Cepko, C.L. (2008) A core paired-type and POU homeodomain-containing transcription factor program drives retinal bipolar cell gene expression. J. Neurosci. In press.

Proper citation: RRID:Addgene_18807 Copy   


http://www.addgene.org/18809

Genetic Insert: SV40 basal promoter-tdTomato-IRES-AP
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18667607
Comments: also known as gtia1, Kim, D.S., Matsuda, T., and Cepko, C.L. (2008) A core paired-type and POU homeodomain-containing transcription factor program drives retinal bipolar cell gene expression. J. Neurosci. In press.

Proper citation: RRID:Addgene_18809 Copy   


  • RRID:Addgene_18880

    This resource has 1+ mentions.

http://www.addgene.org/18880

Species: A. victoria
Genetic Insert: GFPuv
Vector Backbone Description: Backbone Size:5064; Vector Backbone:pPro24; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16269719

Proper citation: RRID:Addgene_18880 Copy   


  • RRID:Addgene_18882

    This resource has 1+ mentions.

http://www.addgene.org/18882

Species: Homo sapiens
Genetic Insert: Yap1 Y357F
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18280240

Proper citation: RRID:Addgene_18882 Copy   


http://www.addgene.org/18883

Species: Homo sapiens
Genetic Insert: Yap1 Y357E
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18280240

Proper citation: RRID:Addgene_18883 Copy   


  • RRID:Addgene_18886

http://www.addgene.org/18886

Species: Saccharomyces cerevisiae
Genetic Insert: Ste7
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pYBS311; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8062390
Comments: Lex-Ste7C has the 1 kb BglII-BamHI fragment of pYEE129 at BamHI of pYBS311

Proper citation: RRID:Addgene_18886 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X