SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 120 showing 2381 ~ 2400 out of 743,073 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_31266

    This resource has 1+ mentions.

http://www.addgene.org/31266

Genetic Insert: GCGFP
Vector Backbone Description: Backbone Size:2316; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_31266 Copy   


  • RRID:Addgene_31269

http://www.addgene.org/31269

Genetic Insert: XRDRE
Vector Backbone Description: Backbone Size:1994; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_31269 Copy   


  • RRID:Addgene_31260

http://www.addgene.org/31260

Species: Xenopus laevis
Genetic Insert: Xenopus FGFR4-ICD-FKBP
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20013652

Proper citation: RRID:Addgene_31260 Copy   


  • RRID:Addgene_31306

    This resource has 1+ mentions.

http://www.addgene.org/31306

Genetic Insert: ECFP(loxP)EYFP
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12682379
Comments: Cre reporter: from blue fluorescence to yellow fluorescence

Proper citation: RRID:Addgene_31306 Copy   


  • RRID:Addgene_31305

    This resource has 1+ mentions.

http://www.addgene.org/31305

Species: Homo sapiens
Genetic Insert: Mesothelin
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21505261
Comments: Msln Promoter sequence provided by author (see above link) Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid. Msln-1F: TCATTTGTTCCCTTTGACGGC Msln-1R: CTCTCCCCAGCATCCACATTC Expect 987 nt product Msln-2F: TTGCCTACAACACCCTGCTGCG Msln-2R: GCTCACAATGCTTCCATCAAACG Expect 792 nt product

Proper citation: RRID:Addgene_31305 Copy   


  • RRID:Addgene_31309

http://www.addgene.org/31309

Species: Xenopus laevis
Genetic Insert: cardiac actin / Cre
Vector Backbone Description: Backbone Size:3000; Vector Backbone:N/A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12682379
Comments: pCARGFP (Kroll et al 1996) used to replace the GFP with Cre from pCSCre2

Proper citation: RRID:Addgene_31309 Copy   


  • RRID:Addgene_31254

    This resource has 1+ mentions.

http://www.addgene.org/31254

Species: Homo sapiens
Genetic Insert: Human Homologue of Ariadne (HHARI)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21532592
Comments: Capili AD, Edghill EL, Wu, K and Borden KL (2004)Structure of the C-terminal RING Finger from a RING-IBR-RING/TRIAD Motif Reveals a Novel Zinc-binding Domain Distinct from a RING. J. Mol. Bio. 340:1117-29.

Proper citation: RRID:Addgene_31254 Copy   


  • RRID:Addgene_31253

    This resource has 1+ mentions.

http://www.addgene.org/31253

Species: Homo sapiens
Genetic Insert: Huntingtin-interacting protein 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12163454

Proper citation: RRID:Addgene_31253 Copy   


  • RRID:Addgene_31366

    This resource has 1+ mentions.

http://www.addgene.org/31366

Species: Mus musculus
Genetic Insert: Clock
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pcDNA4a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21613214

Proper citation: RRID:Addgene_31366 Copy   


  • RRID:Addgene_31368

http://www.addgene.org/31368

Species: Mus musculus
Genetic Insert: Cry1
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21613214

Proper citation: RRID:Addgene_31368 Copy   


  • RRID:Addgene_31367

    This resource has 1+ mentions.

http://www.addgene.org/31367

Species: Mus musculus
Genetic Insert: Bmal1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21613214

Proper citation: RRID:Addgene_31367 Copy   


  • RRID:Addgene_31402

http://www.addgene.org/31402

Species: Mus musculus
Genetic Insert: Nuclear Factor IX isoform 2
Vector Backbone Description: Backbone Marker:MacGregor and Caskey; Backbone Size:3771; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9660824

Proper citation: RRID:Addgene_31402 Copy   


  • RRID:Addgene_31407

http://www.addgene.org/31407

Species: Homo sapiens
Genetic Insert: Ubiquitin Conjugating Enzyme
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:8100; Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17873885

Proper citation: RRID:Addgene_31407 Copy   


  • RRID:Addgene_31351

    This resource has 1+ mentions.

http://www.addgene.org/31351

Species: Homo sapiens
Genetic Insert: Brd4FL
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454

Proper citation: RRID:Addgene_31351 Copy   


http://www.addgene.org/31353

Species: Homo sapiens
Genetic Insert: Brd4 444-722
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454

Proper citation: RRID:Addgene_31353 Copy   


http://www.addgene.org/31355

Species: Homo sapiens
Genetic Insert: Brd4 1224-1362
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454

Proper citation: RRID:Addgene_31355 Copy   


http://www.addgene.org/31354

Species: Homo sapiens
Genetic Insert: Brd4 1047-1362
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454

Proper citation: RRID:Addgene_31354 Copy   


http://www.addgene.org/31358

Species: Homo sapiens
Genetic Insert: JMJD6
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454

Proper citation: RRID:Addgene_31358 Copy   


  • RRID:Addgene_31342

http://www.addgene.org/31342

Species: Homo sapiens
Genetic Insert: mitochondrial ribosomal protein S2 mature form
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18539099

Proper citation: RRID:Addgene_31342 Copy   


  • RRID:Addgene_31346

http://www.addgene.org/31346

Species: Mus musculus
Genetic Insert: Cry1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4856; Vector Backbone:pFastBacHTa; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21613214

Proper citation: RRID:Addgene_31346 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X