Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: GCGFP
Vector Backbone Description: Backbone Size:2316; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_31266 Copy
Genetic Insert: XRDRE
Vector Backbone Description: Backbone Size:1994; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_31269 Copy
Species: Xenopus laevis
Genetic Insert: Xenopus FGFR4-ICD-FKBP
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20013652
Proper citation: RRID:Addgene_31260 Copy
Genetic Insert: ECFP(loxP)EYFP
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12682379
Comments: Cre reporter: from blue fluorescence to yellow fluorescence
Proper citation: RRID:Addgene_31306 Copy
Species: Homo sapiens
Genetic Insert: Mesothelin
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21505261
Comments: Msln Promoter sequence provided by author (see above link)
Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid.
Msln-1F: TCATTTGTTCCCTTTGACGGC
Msln-1R: CTCTCCCCAGCATCCACATTC
Expect 987 nt product
Msln-2F: TTGCCTACAACACCCTGCTGCG
Msln-2R: GCTCACAATGCTTCCATCAAACG
Expect 792 nt product
Proper citation: RRID:Addgene_31305 Copy
Species: Xenopus laevis
Genetic Insert: cardiac actin / Cre
Vector Backbone Description: Backbone Size:3000; Vector Backbone:N/A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12682379
Comments: pCARGFP (Kroll et al 1996) used to replace the GFP with Cre from pCSCre2
Proper citation: RRID:Addgene_31309 Copy
Species: Homo sapiens
Genetic Insert: Human Homologue of Ariadne (HHARI)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21532592
Comments: Capili AD, Edghill EL, Wu, K and Borden KL (2004)Structure of the C-terminal RING Finger from a RING-IBR-RING/TRIAD Motif Reveals a Novel Zinc-binding Domain Distinct from a RING. J. Mol. Bio. 340:1117-29.
Proper citation: RRID:Addgene_31254 Copy
Species: Homo sapiens
Genetic Insert: Huntingtin-interacting protein 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12163454
Proper citation: RRID:Addgene_31253 Copy
Species: Mus musculus
Genetic Insert: Clock
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pcDNA4a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21613214
Proper citation: RRID:Addgene_31366 Copy
Species: Mus musculus
Genetic Insert: Cry1
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21613214
Proper citation: RRID:Addgene_31368 Copy
Species: Mus musculus
Genetic Insert: Bmal1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21613214
Proper citation: RRID:Addgene_31367 Copy
Species: Mus musculus
Genetic Insert: Nuclear Factor IX isoform 2
Vector Backbone Description: Backbone Marker:MacGregor and Caskey; Backbone Size:3771; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9660824
Proper citation: RRID:Addgene_31402 Copy
Species: Homo sapiens
Genetic Insert: Ubiquitin Conjugating Enzyme
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:8100; Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17873885
Proper citation: RRID:Addgene_31407 Copy
Species: Homo sapiens
Genetic Insert: Brd4FL
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454
Proper citation: RRID:Addgene_31351 Copy
Species: Homo sapiens
Genetic Insert: Brd4 444-722
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454
Proper citation: RRID:Addgene_31353 Copy
Species: Homo sapiens
Genetic Insert: Brd4 1224-1362
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454
Proper citation: RRID:Addgene_31355 Copy
Species: Homo sapiens
Genetic Insert: Brd4 1047-1362
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454
Proper citation: RRID:Addgene_31354 Copy
Species: Homo sapiens
Genetic Insert: JMJD6
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454
Proper citation: RRID:Addgene_31358 Copy
Species: Homo sapiens
Genetic Insert: mitochondrial ribosomal protein S2 mature form
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18539099
Proper citation: RRID:Addgene_31342 Copy
Species: Mus musculus
Genetic Insert: Cry1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4856; Vector Backbone:pFastBacHTa; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21613214
Proper citation: RRID:Addgene_31346 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.