Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: E2F1-P!P3A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19081076
Proper citation: RRID:Addgene_37142 Copy
Species: Drosophila melanogaster
Genetic Insert: hopscotch
Vector Backbone Description: Backbone Size:8900; Vector Backbone:pCaSpeR-hs; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #99
Proper citation: RRID:Addgene_37299 Copy
Species: Drosophila melanogaster
Genetic Insert: ovoD1 genomic DNA fragment
Vector Backbone Description: Backbone Size:7815; Vector Backbone:pCaSpeR 2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8306893
Comments: Perrimon Lab plasmid #25
Please see associated publication for cloning details
Proper citation: RRID:Addgene_37282 Copy
Species: Drosophila melanogaster
Genetic Insert: orthodenticle
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBlueScript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1979296
Comments: Perrimon Lab plasmid #46
Proper citation: RRID:Addgene_37285 Copy
Species: Drosophila melanogaster
Genetic Insert: SOCS36E enhancer fragment
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression, Luciferase, JAK/STAT reporter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16055650
Comments: Perrimon Lab plasmid #446
A 441-bp genomic fragment in the enhancer of SOCS36E containing two potential STAT92E-binding sites was amplified by PCR, using five different sets of oligos: (1) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (2) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), CTGCAGATACAAAACTGTCTTAGGTGTTTA (PstI); (3) GAATTCGAACCACTCAGAGTGCCTGCGTGT (EcoRI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (4) AGATCTGAACCACTCAGAGTGCCTGCGTGT (BglII), AGATCTATACAAAACTGTCTTAGGTGTTTA (BglII); (5) GCGGCCGCGAACCACTCAGAGTGCCTGCGTGT (NotI), GCGGCCGCATACAAAACTGTCTTAGGTGTTTA (NotI).
Each amplified genomic fragment containing different restriction enzyme sites was sequentially subcloned into pUAST. The genomic fragment amplified using the first set of oligos was subcloned into the PstI/EcoRI sites of pUAST to generate 2XSTAT92E. The genomic fragment amplified using the second set of oligos was subcloned into the PstI site of 2XSTAT92E to generate 4XSTAT92E. The genomic fragment amplified using the third set of oligos was subcloned into the EcoRI site of 4XSTAT92E to generate 6XSTAT92E. The genomic fragment amplified using the fourth set of oligos was subcloned into the BglII site of 6XSTAT92E to generate 8XSTAT92E.
Next, the hsp70 minimal promoter element was amplified from pUAST by PCR using oligos GCGGCCGCAGCGGAGACTCTAGCGAGCG (NotI) and CTCGAGAATTCCCTATTCAGAGTTCT (XhoI). This
hsp70 minimal promoter was subcloned into the NotI/XhoI sites of 8XSTAT92E to generate 8XSTAT92E–hsp70. Again, the genomic fragment amplified using the fifth set of oligos was subcloned into the NotI site of 8XSTAT92E–hsp70 vector to generate 10XSTAT92E–hsp70.
Finally, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3–luciferase vector (Promega) was subcloned into the XhoI/XbaI sites of 10XSTAT92E–hsp70 to generate 10XSTAT92E–luciferase.
Proper citation: RRID:Addgene_37393 Copy
Species: Drosophila melanogaster
Genetic Insert: ovoD1 genomic DNA fragment
Vector Backbone Description: Backbone Size:7815; Vector Backbone:pCaSpeR 2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8306893
Comments: Perrimon Lab plasmid #23
Please see associated publication for cloning details
Proper citation: RRID:Addgene_37280 Copy
Species: Drosophila melanogaster
Genetic Insert: hopscotch
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #100
Proper citation: RRID:Addgene_37301 Copy
Species: Drosophila melanogaster
Genetic Insert: hopTum-1
Vector Backbone Description: Backbone Marker:Addgene plasmid# 37299; Vector Backbone:pCaShs-hopscotch; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #101
The pCaShs-Tum construct was generated by the replacement of a 220 bp SacII-BstEII fragment from pCaShs-hop (Addgene plasmid# 37299) with the same fragment of PCR-generated DNA from hopTum-1 hemizygous flies.
This mutation is a G to A transversion at nucleotide 1641 resulting in the substitution of a Glu for a Gly at amino acid 341.
Proper citation: RRID:Addgene_37303 Copy
Species: Drosophila melanogaster
Genetic Insert: hopTum-1
Vector Backbone Description: Backbone Size:8904; Vector Backbone:pUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7796812
Comments: Perrimon Lab plasmid #102
The pUAS-Tum was made by the insertion of the NotI-XbaI fragment from pCaShs-Tum (Addgene plasmid# 37303) into pUAST.
Proper citation: RRID:Addgene_37304 Copy
Species: Drosophila melanogaster
Genetic Insert: porcupine
Vector Backbone Description: Backbone Size:7855; Vector Backbone:pCaSpeR-4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8985181
Comments: Perrimon Lab plasmid #123
The EcoRI-XbaI genomic DNA covering the porc locus was cloned in pCaspeR4 to generate a genomic porc rescue construct.
Proper citation: RRID:Addgene_37376 Copy
Species: Drosophila melanogaster
Genetic Insert: porcupine
Vector Backbone Description: Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8985181
Comments: Perrimon Lab plasmid #124
Proper citation: RRID:Addgene_37377 Copy
Species: Drosophila melanogaster
Genetic Insert: PolIII-Renilla control reporter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3320; Vector Backbone:pRL-null; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16311596
Comments: Perrimon Lab plasmid #414
The PolIII–Renilla luciferase control construct was generated by PCR amplification of a fragment (base pairs 43,224–43,389 of scaffold AE003823) of the promoter of the D. melanogaster RNA PolIII 128 subunit (RpIII128) with a 5' BglII and a 3' SpeI site and ligation of this fragment into the BglII and SpeI sites of pRL-null.
Proper citation: RRID:Addgene_37380 Copy
Species: Drosophila melanogaster
Genetic Insert: tout-velu
Vector Backbone Description: Vector Backbone:pNB40; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9665133
Comments: Perrimon Lab plasmid #179
Proper citation: RRID:Addgene_37401 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab39
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17409086
Proper citation: RRID:Addgene_37745 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab35
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17409086
Proper citation: RRID:Addgene_37741 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab32
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17409086
Proper citation: RRID:Addgene_37740 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab30
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17409086
Comments: This construct contains a SNP - S111P.
Proper citation: RRID:Addgene_37736 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab30
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17409086
Comments: This construct contains a SNP - S111P.
Proper citation: RRID:Addgene_37737 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab6
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17409086
Proper citation: RRID:Addgene_37697 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab6
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17409086
Proper citation: RRID:Addgene_37698 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
