Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: yeGFP
Vector Backbone Description: Backbone Marker:EUROSCARF; Backbone Size:6091; Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34939781
Comments: This plasmid was used as a template to amplify the reporter cassette for the genomic integration.
Proper citation: RRID:Addgene_177162 Copy
Species: Synthetic
Genetic Insert: yeCherry
Vector Backbone Description: Backbone Marker:EUROSCARF; Backbone Size:6088; Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34939781
Comments: This plasmid was used as a template to amplify the reporter cassette for the genomic integration.
Proper citation: RRID:Addgene_177165 Copy
Species: Synthetic
Genetic Insert: yeCherry
Vector Backbone Description: Backbone Marker:EUROSCARF; Backbone Size:6088; Vector Backbone:pRS426; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34939781
Comments: This plasmid was used as a template to amplify the reporter cassette for the genomic integration.
Proper citation: RRID:Addgene_177164 Copy
Species: Synthetic
Genetic Insert: PCP-VP64
Vector Backbone Description: Backbone Marker:EUROSCARF; Backbone Size:7364; Vector Backbone:pRS42K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34939781
Proper citation: RRID:Addgene_177156 Copy
Species: Synthetic
Genetic Insert: PCP-VP64
Vector Backbone Description: Backbone Marker:EUROSCARF; Backbone Size:7364; Vector Backbone:pRS42K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34939781
Proper citation: RRID:Addgene_177157 Copy
Species: Synthetic
Genetic Insert: Tandem dimer superfolder GFP
Vector Backbone Description: Backbone Marker:Hyung-song Nam, Capecchi laboratory; Vector Backbone:Custom; Vector Types:Mammalian Expression, dre / rox ; piggyBac; Bacterial Resistance:Ampicillin
Comments: When utilized in a reporter knocked in into a genomic locus, the stop cassette in this expression vector leaked in vivo (https://doi.org/10.6084/m9.figshare.16570695.v5).
Four nucleotides that were previously missing in the 5' end of the WPRE were added back, and SnapGene now recognizes it as WPRE.
Proper citation: RRID:Addgene_177150 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting the PEAR-GFP plasmid
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35196219
Comments: Read the preprint at bioRxiv: https://www.biorxiv.org/content/10.1101/2021.04.26.441486v1.
Proper citation: RRID:Addgene_177183 Copy
Species: Synthetic
Genetic Insert: pegRNA targeting the PEAR-GFP plasmid
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35196219
Comments: Read the preprint at bioRxiv: https://www.biorxiv.org/content/10.1101/2021.04.26.441486v1.
Proper citation: RRID:Addgene_177182 Copy
Species: Synthetic
Genetic Insert: EGFP split with an intron between amino acids 95-96
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35196219
Comments: Read the preprint at bioRxiv: https://www.biorxiv.org/content/10.1101/2021.04.26.441486v1.
Proper citation: RRID:Addgene_177186 Copy
Species: Synthetic
Genetic Insert: hyperPE2
Vector Backbone Description: Backbone Size:3331; Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34556671
Proper citation: RRID:Addgene_177173 Copy
Species: Synthetic
Genetic Insert: mTagBFP2-T2A-iCreERT2
Vector Backbone Description: Backbone Marker:Hyung-song Nam, Capecchi laboratory; Vector Backbone:Custom; Vector Types:Mammalian Expression, Cre/Lox, piggyBac; Bacterial Resistance:Ampicillin
Comments: Optimized T2A sequence: https://doi.org/10.6084/m9.figshare.13636142.v79.
pCAGGS-mTagBFP2-T2A-iCreERT2 (PAGSAS) (#137864, https://www.addgene.org/137864/) was updated with (1) improved Kozak consensus sequence, (2) a slightly different codon usage in the 5' linker of the T2A, (3) a silently mutated XhoI site in iCre was reverted, and (4) four nucleotides were restored to the 5' of the WPRE.
Proper citation: RRID:Addgene_177308 Copy
Species: Synthetic
Genetic Insert: RFP, CauNEO
Vector Backbone Description: Backbone Size:2683; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34893621
Proper citation: RRID:Addgene_177277 Copy
Species: Synthetic
Genetic Insert: DREADD Gi-mCherry
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4591; Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, INTRSECT; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_177673 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting ACO1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: CCACTACCCCAACCTGGCGG
Proper citation: RRID:Addgene_169892 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting IREB2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: AATGCACCAAATCCTGGAGG
Proper citation: RRID:Addgene_169894 Copy
Species: Synthetic
Genetic Insert: OxLight1
Vector Backbone Description: Backbone Marker:Viral Vector Facility - University of Zurich; Backbone Size:4438; Vector Backbone:pAAV.hSynapsin1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35145320
Proper citation: RRID:Addgene_169792 Copy
Species: Synthetic
Genetic Insert: eGFP
Vector Backbone Description: Backbone Size:8535; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556
Proper citation: RRID:Addgene_169745 Copy
Species: Synthetic
Genetic Insert: tetR-P2A-eGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6113; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556
Comments: Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.
Proper citation: RRID:Addgene_169747 Copy
Species: Synthetic
Genetic Insert: RRRAA
Vector Backbone Description: Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34369028
Proper citation: RRID:Addgene_170112 Copy
Species: Synthetic
Genetic Insert: UUUUA
Vector Backbone Description: Vector Backbone:pHG165c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34369028
Proper citation: RRID:Addgene_170107 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
