Plasmids   Select Another Resource Report Type

http://www.addgene.org/26643

Species: e. coli
Genetic Insert: pZE21-GFPaav
Vector Backbone Description: Backbone Size:2117; Vector Backbone:pZE21; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10659856
Comments: Note that there are some discrepancies between Addgene's QC sequence and the depositor's sequence. These differences are not known to affect function.

Proper citation: RRID:Addgene_26643 Copy   

•   Source: Addgene
  

http://www.addgene.org/26642

Species: Homo sapiens
Genetic Insert: Apoptotic protease activating factor 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16630894

Proper citation: RRID:Addgene_26642 Copy   

•   Source: Addgene
  

http://www.addgene.org/26644

Species: Mus musculus
Genetic Insert: Δ90beta catenin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Δ90AEGFP is Δ90betacatenin fused with EGFP-mut4 from Ami Okada

Proper citation: RRID:Addgene_26644 Copy   

•   Source: Addgene
  

http://www.addgene.org/26641

Genetic Insert: IHF
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5443; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Use Rosetta(DE3)plysS cells for expression. Please note that the IHF insert is NOT expressed with a His tag.

Proper citation: RRID:Addgene_26641 Copy   

•   Source: Addgene
  

http://www.addgene.org/26658

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9514715
Comments: This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"603". Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence.

Proper citation: RRID:Addgene_26658 Copy   

•   Source: Addgene
  

http://www.addgene.org/26657

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9514715
Comments: This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"602". Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence.

Proper citation: RRID:Addgene_26657 Copy   

•   Source: Addgene
  

http://www.addgene.org/26659

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9514715
Comments: This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"605". Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence.

Proper citation: RRID:Addgene_26659 Copy   

•   Source: Addgene
  

http://www.addgene.org/26654

Species: Epstein-Barr Virus
Genetic Insert: Latent Membrane Protein 1
Vector Backbone Description: Backbone Size:4107; Vector Backbone:pSG5 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11387199

Proper citation: RRID:Addgene_26654 Copy   

•   Source: Addgene
  

http://www.addgene.org/26653

Species: Homo sapiens
Genetic Insert: β3-integrin
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11967230

Proper citation: RRID:Addgene_26653 Copy   

•   Source: Addgene
  

http://www.addgene.org/26656

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9514715
Comments: This plasmid contains a 147 bp nucleosome positioning sequence and is referred to as clone"601". Primers that are used by the Widom lab to amplify the 147 bp fragment: Forward: ctggagaatcccggtgccg Reverse: acaggatgtatatatctgacacg Please note that there may be discrepancies between Addgene's sequencing results and the depositor's sequence. Potential discrepancies are not a concern according to the depositing scientist because the clones were selected for their ability to bind to histone octamer, not for their specific sequence.

Proper citation: RRID:Addgene_26656 Copy   

•   Source: Addgene
  

http://www.addgene.org/26655

Vector Backbone Description: Backbone Marker:David Root; Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20890297

Proper citation: RRID:Addgene_26655 Copy   

•   Source: Addgene
  

http://www.addgene.org/26625

Species: Homo sapiens
Genetic Insert: Rheb1 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18497260
Comments: shRNA directed against Rheb1. Target sequence: 5'-CCTCAGACATACTCCATAGAT-3'.

Proper citation: RRID:Addgene_26625 Copy   

•   Source: Addgene
  

http://www.addgene.org/26627

Species: Homo sapiens
Genetic Insert: RagB shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18497260
Comments: shRNA directed against RagB. Target sequence: 5'-CGGGACAACATCTTCCGAAAT-3'. Sequence from the website of the RNAi consortium at the Broad institute.

Proper citation: RRID:Addgene_26627 Copy   

•   Source: Addgene
  

http://www.addgene.org/26626

Species: Homo sapiens
Genetic Insert: Rheb1 shRNA
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18497260
Comments: shRNA directed against Rheb1. Target sequence: 5'-TTATGTTGGTTGGGAATAAGA-3'.

Proper citation: RRID:Addgene_26626 Copy   

•   Source: Addgene
  

http://www.addgene.org/26588

Species: mammalian codon optimized
Genetic Insert: iLOV
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19060199
Comments: iLOV codon usage was optimized for mammalian cell expression by de novo gene synthesis (GenScript) and cloned into pEGFP-N1 (Clontech) via SalI and NotI to replace the GFP encoding sequence.

Proper citation: RRID:Addgene_26588 Copy   

•   Source: Addgene
  

http://www.addgene.org/26587

Species: Arabidopsis thaliana
Genetic Insert: iLOV
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19060199

Proper citation: RRID:Addgene_26587 Copy   

•   Source: Addgene
  

http://www.addgene.org/26584

Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Size:7580; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin
Comments: Need to be transduced in a Tet-On Advanced cell line for expression of the GFP. There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence difference does not affect plasmid function.

Proper citation: RRID:Addgene_26584 Copy   

•   Source: Addgene
  

http://www.addgene.org/26586

Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Size:8045; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin
Comments: Need to be transduced in a Tet-On Advanced cell line for expression of GFP. There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence differences do not affect GFP expression or general plasmid function.

Proper citation: RRID:Addgene_26586 Copy   

•   Source: Addgene
  

http://www.addgene.org/26585

Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Size:8568; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Tet-On Advanced vector; Bacterial Resistance:Ampicillin
Comments: Need to be transduced in a Tet-On Advanced cell line for expression of GFP. There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence differences do not affect GFP expression or general plasmid function.

Proper citation: RRID:Addgene_26585 Copy   

•   Source: Addgene
  

http://www.addgene.org/26580

Species: Aequorea victoria
Genetic Insert: destabilized GFP
Vector Backbone Description: Backbone Size:0; Vector Backbone:pLuxI-tet8 + pRKM-102; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:15096621
Comments: A novel hybrid promoter luxPRcI-OR1 (wild-type luxPR promoter with a CI OR1 operator site inserted at the +1 transcription start) drives expression of GFP(LVA). The promoter was constructed by encoding OR1 on PCR primers and inserting it after luxPR

Proper citation: RRID:Addgene_26580 Copy   

•   Source: Addgene