Plasmids   Select Another Resource Report Type

http://www.addgene.org/55218

Vector Backbone Description: Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28668116
Comments: In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-A is an untagged pFastBac LIC Subcloning vector. The 438 vectors use the LICvBac Forward primer and the LICv1 Reverse primer. LICvBacF - 5'-TACTTCCAATCCAATCG-3' (Note: ATG must be added to ORF) LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_55218 Copy   

•   Source: Addgene

http://www.addgene.org/55186

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7266; Vector Backbone:pET, pCoofy3; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55186 Copy   

•   Source: Addgene

http://www.addgene.org/55185

Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:6383; Vector Backbone:pFastBac; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55185 Copy   

•   Source: Addgene

http://www.addgene.org/55184

Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:6063; Vector Backbone:pFastBac; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55184 Copy   

•   Source: Addgene

http://www.addgene.org/55183

Species: Synthetic
Genetic Insert: cMyc tag
Vector Backbone Description: Backbone Marker:iGEM; Backbone Size:2070; Vector Backbone:pSB1C3; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24295448
Comments: For sequencing of insert, use the following primers: fwd: TGCCACCTGACGTCTAAG rev: ATTACCGCCTTTGAGTGA

Proper citation: RRID:Addgene_55183 Copy   

•   Source: Addgene

http://www.addgene.org/55223

Vector Backbone Description: Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28668116
Comments: In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-SNAP-V3 has a TEV cleavable TwinStrepII-Prescission-SNAPf on the C-terminus. The 438-SNAP-V3 vector use the LICv3 Forward and Reverse primers. LICv3 Forward - 5'-TTTAAGAAGGAGATATAGTTC-3' LICv3 Reverse - 5'-GGATTGGAAGTAGAGGTTCTC-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_55223 Copy   

•   Source: Addgene

http://www.addgene.org/55221

Vector Backbone Description: Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28668116
Comments: In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-Rgfp has a TEV cleavable StrepII and msfGFP at the N-terminus. The 438-Rgfp vector use the LICv1 Forward and Reverse primers. LICv1Forward - 5'-TACTTCCAATCCAATGCA-3' LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_55221 Copy   

•   Source: Addgene

http://www.addgene.org/55187

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7701; Vector Backbone:pET, pCoofy4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55187 Copy   

•   Source: Addgene

http://www.addgene.org/63357

Species: Synthetic
Genetic Insert: NI NN NG
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63357 Copy   

•   Source: Addgene

http://www.addgene.org/63358

Species: Synthetic
Genetic Insert: NI NG NI
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63358 Copy   

•   Source: Addgene

http://www.addgene.org/63353

Species: Synthetic
Genetic Insert: NI HD NG
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63353 Copy   

•   Source: Addgene

http://www.addgene.org/63354

Species: Synthetic
Genetic Insert: NI NN NI
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63354 Copy   

•   Source: Addgene

http://www.addgene.org/63355

Species: Synthetic
Genetic Insert: NI NN HD
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63355 Copy   

•   Source: Addgene

http://www.addgene.org/63356

Species: Synthetic
Genetic Insert: NI NN NN
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63356 Copy   

•   Source: Addgene

http://www.addgene.org/63350

Species: Synthetic
Genetic Insert: NI NI NG
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63350 Copy   

•   Source: Addgene

http://www.addgene.org/63351

Species: Synthetic
Genetic Insert: NI HD NI
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63351 Copy   

•   Source: Addgene

http://www.addgene.org/63401

Species: Synthetic
Genetic Insert: NG HD NG
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63401 Copy   

•   Source: Addgene

http://www.addgene.org/63369

Species: Synthetic
Genetic Insert: HD HD NG
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63369 Copy   

•   Source: Addgene

http://www.addgene.org/63404

Species: Synthetic
Genetic Insert: NG NN NN
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63404 Copy   

•   Source: Addgene

http://www.addgene.org/63400

Species: Synthetic
Genetic Insert: NG HD NN
Vector Backbone Description: Backbone Size:3015; Vector Backbone:FusX3; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63400 Copy   

•   Source: Addgene