Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: GFP-RT-GFP
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42157 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874
Proper citation: RRID:Addgene_42037 Copy
Genetic Insert: YFP-RT-YFP
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42158 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874
Proper citation: RRID:Addgene_42038 Copy
Species: Synthetic
Genetic Insert: RT-cassette
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:7904; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition enabling stable propagation of RT-cassette. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42150 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874
Proper citation: RRID:Addgene_42030 Copy
Species: Homo sapiens
Genetic Insert: c-Myc
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6157; Vector Backbone:pcDNA3.1/CT-GFP-TOPO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21668996
Proper citation: RRID:Addgene_42142 Copy
Species: Synthetic
Genetic Insert: pCMV-N1-superfolderGFP
Vector Backbone Description: Vector Backbone:pNICE; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22355283
Proper citation: RRID:Addgene_42143 Copy
Species: Caenorhabditis elegans
Genetic Insert: N-TAP TAG::[(G4S)3]::mTFP1
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]
Proper citation: RRID:Addgene_42145 Copy
Species: Caenorhabditis elegans
Genetic Insert: N-TAP-tag::mTFP1
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]
Proper citation: RRID:Addgene_42146 Copy
Species: Caenorhabditis elegans
Genetic Insert: mTFP1
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]
Proper citation: RRID:Addgene_42147 Copy
Species: Mus musculus
Genetic Insert: Frizzled 7
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42259 Copy
Genetic Insert: Streptococcus pyogenes Cas9-3X Flag
Vector Backbone Description: Vector Backbone:unknown; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23360964
Comments: Plasmid Features:
CAG enhancer-CMV promoter = 7466-370
Cas9 = 409-4512
NLS = 4519-4539
3X FLAG = 4546-4611
BGHpA = 4612-4839
Proper citation: RRID:Addgene_42252 Copy
Species: Mus musculus
Genetic Insert: Frizzled 2
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Comments: Fzd2 insert contains S193A compared with NM_020510.2. Mutation has no effect on plasmid function
Proper citation: RRID:Addgene_42254 Copy
Species: Mus musculus
Genetic Insert: Frizzled 4
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42256 Copy
Species: Mus musculus
Genetic Insert: Frizzled 6
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42258 Copy
Vector Backbone Description: Backbone Marker:Joung lab DR274; Backbone Size:2147; Vector Backbone:Zebrafish-gRNA-ExpressionVector; Vector Types:Worm Expression, CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Proper citation: RRID:Addgene_42250 Copy
Species: Danio rerio
Genetic Insert: gRNA-tia1l
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGTATGTCGGGAACCTCTCC
Guide RNA sequence: TAATACGACTCACTATAGGTATGTCGGGAACCTCTCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA
Proper citation: RRID:Addgene_42248 Copy
Genetic Insert: PSD95
Vector Backbone Description: Vector Backbone:pCS6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103964
Proper citation: RRID:Addgene_42240 Copy
Species: Danio rerio
Genetic Insert: gRNA-drd3
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAAACTACAGCCCAGCGTC
Guide RNA sequence: TAATACGACTCACTATAGGAAACTACAGCCCAGCGTCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA
Proper citation: RRID:Addgene_42242 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
