Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pYCTK018 Resource Report Resource Website |
RRID:Addgene_176722 | mfalpha1Vp | Vanderwaltozyma polyspora | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Codon-optimized for expression in S. cerevisiae | 2026-08-01 01:09:00 | 0 | |
|
AAV-EF1a-jGCaMP8f-WPRE Resource Report Resource Website 1+ mentions |
RRID:Addgene_176756 | jGCaMP8f | Rattus norvegicus | Ampicillin | Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:00 | 1 | |||
|
pMvsrcD Resource Report Resource Website |
RRID:Addgene_17670 | v-src | Gallus gallus | Ampicillin | PMID:2161957 | Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:08:59 | 0 | ||
|
Cx43 delta dt GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_17671 | Cx43 | Mus musculus | Ampicillin | Amino acids 234-243 deleted (tubulin binding site). | Backbone Size:0; Vector Backbone:pcDNA3.1/CT-GFP-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | a.a. 234-243 deleted | 2026-08-01 01:08:59 | 1 | |
|
AAV-CamKIIa-jGCaMP8m-WPRE Resource Report Resource Website 1+ mentions |
RRID:Addgene_176751 | jGCaMP8m | Rattus norvegicus | Ampicillin | Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:00 | 3 | |||
|
AAV-CamKIIa-jGCaMP8f-WPRE Resource Report Resource Website 1+ mentions |
RRID:Addgene_176750 | jGCaMP8f | Rattus norvegicus | Ampicillin | Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:00 | 3 | |||
|
AAV-mDlx-jGCaMP8f-WPRE Resource Report Resource Website |
RRID:Addgene_176753 | jGCaMP8f | Rattus norvegicus | Ampicillin | Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:00 | 0 | |||
|
pcSrc416 Resource Report Resource Website |
RRID:Addgene_17676 | c-src Y416F | Gallus gallus | Ampicillin | PMID:3103925 | Based on plasmid pM5HHB5. | Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Tyr 416 changed to Phe . | 2026-08-01 01:09:00 | 0 |
|
pcR295 Resource Report Resource Website 1+ mentions |
RRID:Addgene_17678 | c-src K295R | Gallus gallus | Ampicillin | PMID:1702522 | Based on plasmid pM5HHB5. | Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Lys 295 changed to Arg. | 2026-08-01 01:09:00 | 1 |
|
pcR295/527 Resource Report Resource Website |
RRID:Addgene_17679 | c-src K295R Y527F | Gallus gallus | Ampicillin | PMID:1702522 | Based on plasmid pM5HHB5. This plasmid is unpublished, but related to this article. | Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Lys 295 changed to Arg. Tyr 527 changed to Phe. | 2026-08-01 01:09:00 | 0 |
|
AAV-Syn-H2B-jGCaMP8m-WPRE Resource Report Resource Website |
RRID:Addgene_176748 | H2B-jGCaMP8m | Rattus norvegicus | Ampicillin | Vector Backbone:AAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:00 | 0 | |||
|
pcAla12 Resource Report Resource Website |
RRID:Addgene_17680 | c-src S12A | Gallus gallus | Ampicillin | PMID:2474754 | The pM5HHB5 c-src sequence between nucleotide 1 (numbering from the c-src translational initiator ATG) and nucleotide 43 (at an NaeI site) was replaced with the sequence ATGGGGAGTAGCAAGAGCAAGCCTAAGGATC CCGCTCAGCGCC in pcAlal2. This introduced MstII and BamHI restriction sites near nucleotides 25 and 29, respectively, and changed the AGC (Ser) 12 codon to GCT (Ala) codon yet preserved the remaining the c-src amino acid sequence. | Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Ser 12 changed to Ala. | 2026-08-01 01:09:00 | 0 |
|
pcAla12/Ala17 Resource Report Resource Website |
RRID:Addgene_17682 | c-src S12A S17A | Gallus gallus | Ampicillin | PMID:2474754 | Based on plasmid pM5HHB5. | Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Ser 12 changed to Ala. Ser 17 changed to Ala. | 2026-08-01 01:09:00 | 0 |
|
pcA12/F527 Resource Report Resource Website |
RRID:Addgene_17683 | c-src S12A Y527F | Gallus gallus | Ampicillin | PMID:2474754 | Based on plasmid pM5HHB5. | Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Ser 12 changed to Ala. Tyr 527 changed to Phe . | 2026-08-01 01:09:00 | 0 |
|
pcA17/F527 Resource Report Resource Website |
RRID:Addgene_17684 | c-src S17A Y527F | Gallus gallus | Ampicillin | PMID:2474754 | Based on plasmid pM5HHB5. | Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Ser 17 changed to Ala. Tyr 527 changed to Phe . | 2026-08-01 01:09:00 | 0 |
|
pM5McSrc Resource Report Resource Website 1+ mentions |
RRID:Addgene_17685 | c-src | Mus musculus | Ampicillin | PMID:7530829 | Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:00 | 1 | ||
|
pM5MF529 Resource Report Resource Website 1+ mentions |
RRID:Addgene_17686 | c-src Y529F | Mus musculus | Ampicillin | PMID:7530829 | Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Tyr 529 changed to Phe . | 2026-08-01 01:09:00 | 3 | |
|
pYPQ230-E795L Resource Report Resource Website |
RRID:Addgene_176890 | LbCas12a-E795L | Lachnospiraceae bacterium ND2006 | Spectinomycin | PMID:35174354 | Vector Backbone:pYPQ167; Vector Types:Plant Expression, CRISPR, Gateway compatible LbCpf1 entry clone; Bacterial Resistance:Spectinomycin | 2026-08-01 01:09:01 | 0 | ||
|
pYPQ220-Ultra Resource Report Resource Website |
RRID:Addgene_176889 | AsCas12a | Acidaminococcus sp. BV3L6 | Spectinomycin | PMID:35174354 | Vector Backbone:pYPQ167; Vector Types:Plant Expression, CRISPR, Gateway compatible Cas12a entry clone; Bacterial Resistance:Spectinomycin | 2026-08-01 01:09:01 | 0 | ||
|
pZac2.1-GfaABC1D-lck-jGCaMP8m Resource Report Resource Website |
RRID:Addgene_176760 | lck-jGCaMP8m | Rattus norvegicus | Ampicillin | Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-01 01:09:00 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.