Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Vanderwaltozyma polyspora
Genetic Insert: mfalpha1Vp
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
References:
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176722 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8f
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_176756 Copy
Species: Gallus gallus
Genetic Insert: v-src
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_17670 Copy
Species: Mus musculus
Genetic Insert: Cx43
Vector Backbone Description: Backbone Size:0; Vector Backbone:pcDNA3.1/CT-GFP-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Amino acids 234-243 deleted (tubulin binding site).
Proper citation: RRID:Addgene_17671 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8m
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_176751 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8f
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_176750 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8f
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_176753 Copy
Species: Gallus gallus
Genetic Insert: c-src Y416F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17676 Copy
Species: Gallus gallus
Genetic Insert: c-src K295R
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17678 Copy
Species: Gallus gallus
Genetic Insert: c-src K295R Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5. This plasmid is unpublished, but related to this article.
Proper citation: RRID:Addgene_17679 Copy
Species: Rattus norvegicus
Genetic Insert: H2B-jGCaMP8m
Vector Backbone Description: Vector Backbone:AAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_176748 Copy
Species: Gallus gallus
Genetic Insert: c-src S12A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The pM5HHB5 c-src sequence between nucleotide 1 (numbering from the c-src translational initiator ATG) and nucleotide 43 (at an NaeI site) was replaced with the sequence ATGGGGAGTAGCAAGAGCAAGCCTAAGGATC
CCGCTCAGCGCC in pcAlal2. This introduced MstII and BamHI restriction sites near
nucleotides 25 and 29, respectively, and changed the AGC (Ser) 12 codon to GCT (Ala) codon yet preserved the remaining the c-src amino acid sequence.
Proper citation: RRID:Addgene_17680 Copy
Species: Gallus gallus
Genetic Insert: c-src S12A S17A
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17682 Copy
Species: Gallus gallus
Genetic Insert: c-src S12A Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17683 Copy
Species: Gallus gallus
Genetic Insert: c-src S17A Y527F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Based on plasmid pM5HHB5.
Proper citation: RRID:Addgene_17684 Copy
Species: Mus musculus
Genetic Insert: c-src
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_17685 Copy
Species: Mus musculus
Genetic Insert: c-src Y529F
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_17686 Copy
Species: Lachnospiraceae bacterium ND2006
Genetic Insert: LbCas12a-E795L
Vector Backbone Description: Vector Backbone:pYPQ167; Vector Types:Plant Expression, CRISPR, Gateway compatible LbCpf1 entry clone; Bacterial Resistance:Spectinomycin
References:
Comments:
Proper citation: RRID:Addgene_176890 Copy
Species: Acidaminococcus sp. BV3L6
Genetic Insert: AsCas12a
Vector Backbone Description: Vector Backbone:pYPQ167; Vector Types:Plant Expression, CRISPR, Gateway compatible Cas12a entry clone; Bacterial Resistance:Spectinomycin
References:
Comments:
Proper citation: RRID:Addgene_176889 Copy
Species: Rattus norvegicus
Genetic Insert: lck-jGCaMP8m
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_176760 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
